Abi 3730xl dna analyzer
The ABI 3730xl DNA analyzer is a capillary electrophoresis instrument designed for high-throughput DNA sequencing. It features 96 capillaries and can analyze multiple DNA samples simultaneously. The instrument utilizes fluorescent dye-labeled DNA fragments and laser-induced fluorescence detection to determine the DNA sequence.
3 protocols using abi 3730xl dna analyzer
Optimizing Microsatellite Genotyping of Leopard Cat Fecal DNA
Sequence Diversity Analysis of ZmbHLH16 in Maize
Microsatellite and mtDNA Analysis of Specimens
For the mitochondrial gene, a segment of cytochrome c oxidase subunit I (cox1) was amplified with primer pairs TP‐AF (5′ TTTCGTCTAACCATAAAGATATCGG 3′) and TP‐AR (5′TAAACTTCTGGGTGCCCAAAAAATCA 3′) (Cao et al.,
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!