Abi 3730xl dna analyzer

We repeatedly tried several reaction conditions and annealing temperatures with the fecal DNA samples, based on 20 pairs of microsatellite loci for leopard cats that were used in different studies [28 (link),29 (link)]. Only six of them (Pbe03, Pbe05, Pbe13, Pbe28, Pbe32, and Pbe33) worked properly for our fecal samples (Table 1). The conditions for the PCR reaction were retrieved from Ko et al. 2018 [29 (link)]. We genotyped the samples using the ABI 3730xl DNA analyzer supplied by TsingKe Biotech (the forward primer was labeled with FAM dye at the 5′ end). Each sample was analyzed at least three times to reduce error. If no effective DNA was detected from the heavy degradation, the scat was discarded to ensure the reliability of the three genotyping repeats. Samples amplified with all six loci were considered to be successful and were used in the following analysis.

The genomic sequences of ZmbHLH16, including its 5′ and 3′ untranslated regions (UTRs), were amplified from 78 maize inbred lines (see Table S4 for details) with the primers 5′-GGAAGGAGGAAACCAAGTCG-3′ and 5′-TGTAACGAGCAAGCGGATTTA-3′. PCR was performed according to the manufacturer's protocol using high-fidelity polymerase KOD FX (Toyobo). PCR-amplifying fragments were purified and sequenced directly using an ABI 3730XL DNA Analyzer manufactured by Tsingke Biotech. After ambiguous sequences were manually deleted, the sequence polymorphisms of ZmbHLH16 among the 78 maize inbred lines were analyzed using CodonCode Aligner 6.0.2 software (CodonCode Corporation, Dedham, MA, USA). For molecular evolution analysis, certain parameters were calculated as follows: (1) the nucleotide diversity of common pairwise nucleotide difference per site (π) with DnaSP 5.0 (Librado and Rozas, 2009 (link)); (2) in neutrality tests, the evolutionary pressure in ZmbHLH16 via Tajima's D test (Tajima, 1989 (link)) and Fu and Li's statistics (Fu and Li, 1993 (link)); (3) the LD matrix of ZmbHLH16 was characterized by evaluating r² values based on SNPs and InDels (MAF≥0.05) in TASSEL 2.0 (Bradbury et al., 2007 (link)). An LD plot was obtained in Haploview 4.2 (Barrett et al., 2005 (link)), and the LD decay was assessed by averaging r² values with a distance of 250 bp.

Total DNA was extracted from individual specimens using DNeasy Blood and Tissue Kit (Qiagen). For nuclear markers, we used 22 microsatellite loci developed in a previous study (Gao, Gong, Ma, et al., 2019). A fluorescence‐labeled PC‐tail (5′ CAGGACCAGGCTACCGTG 3′) was used to label the PCR products (Blacket, Robin, Good, Lee, & Miller, 2012; Schuelke, 2000). Conditions for PCR amplification were described in Gao, Gong, Ma, et al. (2019). The size of amplified PCR products was determined using an ABI 3730xl DNA Analyzer with GeneScan 500 LIZ size standards. Alleles were identified with GENEMAPPER version 4.0 (Applied Biosystems, USA).
For the mitochondrial gene, a segment of cytochrome c oxidase subunit I (cox1) was amplified with primer pairs TP‐AF (5′ TTTCGTCTAACCATAAAGATATCGG 3′) and TP‐AR (5′TAAACTTCTGGGTGCCCAAAAAATCA 3′) (Cao et al., 2019). Polymerase chain reaction (PCR) was conducted with the following program: an initial denaturation for 3 min at 94°C, followed by 35 cycles of 30 s at 94°C, 15 s at 52°C and 1 min at 68°C, and a subsequent final extension for 10 min at 68°C. Amplified products were purified and sequenced directly from both strands using an ABI 3730xl DNA Analyzer by Tsingke Biotechnology Co. Ltd.