Ebox vx5

SDS-PAGE was performed according to the method described by Schägger and Von Jagow [28 (link)] using 4% stacking gel (w/v) and 12% polyacrylamide gel (w/v). First, 10 milligrams of protein isolate was dissolved in 1 mL of denaturing buffer for samples, (0.5 M Tris-HCl pH 6.8, glycerol, 10% SDS, 0.5% bromophenol blue, β-mercaptoethanol) and heated at 95 °C. Then, 10 μL of the sample was loaded into the sample wells. Protein separation was performed at 80 V for 30 min, then at 110 V for 90 min for a separation gel using a Mini Protean II device (Bio-Rad Laboratories, Hercules, CA, USA). The gel was stained with brilliant blue for 40 min (Bio-Rad Coomassie R250, Bio-Rad Laboratories, Hercules, CA, USA). Gel bleaching was performed three times using water/methanol/acetic acid (7/2/1 v/v/v) for 15 min each shaking cycle using an orbital shaker (Fristek S10, Taichung, Taiwan). The molecular weight of proteins was evaluated using a protein molecular weight marker (250 to 10 kDa, Bio-Rad Laboratories, Hercules, CA, USA) loaded at a dose of 5 μL into the sample well. Gels were scanned with an E-Box VX5 (Vilber Lourmat, Paris, France), and captured image analysis was performed using Vision Capt software (V16.08a, Vilber Lourmat, Paris, France).

All polymerase chain reaction (PCR) amplification reactions were carried out in a total volume of 25 μL comprising 12.5 μL of 2× BioMix master mix (Bioline, USA), forward and reverse primers (0.50 μL each to give a final concentration of 0.4 M), nuclease-free water (6.5 μL), and DNA template (5.0 μL). A negative control was included in each PCR run, in which the DNA template was replaced with nuclease-free water. All PCR runs were carried out using a MyCycler Thermal Cycler (Applied Biosystems, USA). The PCR primer pair F : 5′ − GCGATTGATGGTGATACGGTT − 3′ and R : 5′ − AGCCAAGCCTTGACGAACTAAAGC − 3′ was used to amplify a 280 bp fragment of the thermonuclease (nuc) gene of S. aureus [22 (link)]. The PCR cycling conditions were optimized at 94°C for 5 min for one cycle of initial denaturation. This was followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 49°C for 1 min, and extension at 72°C for 1 min. The final extension was set at 72°C for 5 min and cooled to 4°C until tubes were removed from the PCR machine. The PCR products were electrophoresed using 1.5% agarose gel (BioShop, Canada) stained with 0.5 mg/L ethidium bromide (Merck, Modderfontein, South Africa) at 100 V for 1 h, in 1 × TBE buffer and viewed under a UV transilluminator (EBOX VX5, Vilber Lourmat, France).

The molecular mass distributions of proteins in the samples were analyzed by SDS‐PAGE (Schägger & Von Jagow, 1987). The protein isolates and hydrolysates were resuspended in denaturant buffer (0.5 M Tris–HCl pH 6.8, glycerol, 10% SDS, w/v, 0.5% bromophenol blue, w/v, β‐mercaptoethanol), at a concentration of 10 mg/ml and heated at 95°C. 10 µl of each sample was loaded onto the 4% stacking gel (w/v) and 12% polyacrylamide gel (w/v). Then, it was run in a Mini‐PROTEAN II unit (Bio‐Rad Laboratories) for 2 hr. Afterward, the gel was stained with Brilliant Blue (Bio‐Rad, Coomassie R250) for 40 min and destained three times using water/methanol/acetic acid (7/2/1, v/v/v), using an orbital shaker (Fristek S10). Thereafter, the gel was scanned with E‐Box VX5 (Vilber Lourmat). The molecular mass of the proteins was measured using a molecular protein mass marker (250 to 10 kDa, Bio‐Rad) loaded at 5 µl in the gel.

Genomic DNA was extracted from the stored blood cells using the ‘salting out’ method [27 (link)] with some modifications [22 (link)]. DNA fragmentation was assessed by agarose gel electrophoresis [28 (link)]. The multiples of about 180-bp nucleosomal units appeared as a DNA ladder when run on the gel. The DNA solution was loaded with loading dye on 1% agarose gel containing 0.6 μg/mL ethidium bromide and electrophoresed at 90 V using Borate buffer (0.25% Boric acid, 0.04% NaOH, pH 8). The electrophoresis was stopped when the bromophenol blue dye had migrated two-thirds of the way down the gel. Appropriate DNA molecular weight markers should be included. The gel was visualized and photographed by an ultraviolet gel documentation system, EBOX VX5 (Vilber Lourmat, Marne La Vallee, France). Densitometric analysis of ladder lanes was done using ImageJ 1.50i (National Institutes of Health, Bethesda, MD, USA, 2016).