Total RNA was extracted from cells using TRIzol® reagent (Gibco, Life Technologies, Carlsbad, CA, USA), following the manufacturer’s instructions. The RNA quantity and quality were assessed through NanoDrop® ND-1000 Spectrophotometer (Waltham, MA, USA). To evaluate transcript changes, 1000 ng of total RNA was reverse-transcribed to cDNA using the “High Capacity cDNA Reverse Transcription Kit” (Applied Biosystems, Carlsbad, CA, USA). The following single-tube TaqMan assays (Applied Biosystems, Carlsbad, CA, USA) were used to detect and quantify genes using the Viia7 DX real time PCR instrument (Life Technologies, Waltham, MA, USA): DNMT1 (Hs00154749_m1), DNMT3a (Hs01027166_m1), DNMT3b (Hs00171876_m1), HDAC1 (Hs02621185_s1), HDAC2 (Hs00231032_m1), HDAC3 (Hs00187320_m1), HDAC4 (Hs01041638_m1), HDAC6 (Hs00195869_m1), and GAPDH (Hs02786624 g1). miRNA expression levels were determined by TaqMan RT-PCR, using the single-tube TaqMan miRNA assays (hsa-miR-29b, assay ID 000413; hsa-miR-22, assay ID 000398, Applied Biosystems) to quantify mature miRNAs, by the use of the StepOne Thermocycler (Thermo Fisher Scientific, Waltham, MA, USA) and the sequence detection system, as previously reported [51 (link)]; miRNAs expression levels were normalized on RNU44 (assay ID 001094). Comparative real-time polymerase chain reaction (RT-PCR) was performed in triplicate.
Viia7 dx real time pcr instrument
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Viia7 DX real-time PCR instrument is a laboratory equipment product designed for nucleic acid amplification and detection. It is capable of performing real-time polymerase chain reaction (PCR) analysis. The Viia7 DX instrument provides thermal cycling, fluorescence detection, and data analysis functionality for various real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Single tube taqman assays, by Thermo Fisher Scientific (1 mentions)
Hsa mir 29b, by Thermo Fisher Scientific (1 mentions)
Stepone thermocycler, by Thermo Fisher Scientific (1 mentions)
Quantichrom calcium assay kit, by BioAssay Systems (1 mentions)
M mlv reverse transcriptase, by Takara Bio (1 mentions)
Ultra sybr mixture with rox, by CWBIO (1 mentions)
Faststart universal probe master kit, by Roche (1 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
5 protocols using viia7 dx real time pcr instrument
1
Quantitative Analysis of Epigenetic Regulators
2
Quantitative Analysis of Muscle Atrophy Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from GC muscle was extracted with Trizol reagent (Gibco, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The RNA quantity and quality were assessed with the NanoDrop ND-2000 Spectrophotometer (Waltham, MA, USA). To evaluate transcript changes, 1000 ng of total RNA was reverse-transcribed to cDNA using the “High Capacity cDNA Reverse Transcription Kit” (Applied Biosystems, Carlsbad, CA, USA).
The following TaqMan gene expression assays (Applied Biosystems, Carlsbad, CA, USA) were used to detect and quantify genes using the Viia7 DX real-time PCR instrument (Life Technologies, Waltham, MA, USA): TRAF-6 (Rn00590197_m1), Fbx32 (Rn00591730_m1), myosin (Myh2) (Rn01470656_m1), myogenin (MyoG) (Rn00567418_m1) and GAPDH (Rn01462661_g1).
The following TaqMan gene expression assays (Applied Biosystems, Carlsbad, CA, USA) were used to detect and quantify genes using the Viia7 DX real-time PCR instrument (Life Technologies, Waltham, MA, USA): TRAF-6 (Rn00590197_m1), Fbx32 (Rn00591730_m1), myosin (Myh2) (Rn01470656_m1), myogenin (MyoG) (Rn00567418_m1) and GAPDH (Rn01462661_g1).
3
Bone Mineral Density and Muscle Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Right and left tibias were isolated and cleaned of soft tissue. The bones were dried at 110°C for 6 hours and weighed, then were ashed at 800°C for 4 hours, weighed again and dissolved in 1mL 6N HCl. Calcium content was determined by colorimetric determination with Quantichrom calcium Assay kit (BioAssay Systems, Hayward, CA).
Reverse Transcription and Quantitative Real Time PCR (qRT-PCR) performed on GC muscle tissue Total RNA from GC muscle was extracted with Trizol reagent (Gibco, Life Technologies, Carlsbad, CA, USA) according to manufacturer's instructions. The RNA quantity and quality were assessed through NanoDrop® ND-2000 Spectrophotometer (Waltham, MA, USA). To evaluate transcript changes, 1000 ng of total RNA was reverse-transcribed to cDNA using the "High Capacity cDNA Reverse Transcription Kit" (Applied Biosystems, Carlsbad, CA, USA).
The following TaqMan gene expression assays (Applied Biosystems, Carlsbad, CA, USA) were used to detect and quantify genes using the Viia7 DX real time PCR instrument (Life Technologies, Waltham, MA, USA): TRAF-6 (Rn00590197_m1), Atrogin-1 (fbx32) (Rn00591730_m1), and GAPDH (Rn01462661_g1).
Reverse Transcription and Quantitative Real Time PCR (qRT-PCR) performed on GC muscle tissue Total RNA from GC muscle was extracted with Trizol reagent (Gibco, Life Technologies, Carlsbad, CA, USA) according to manufacturer's instructions. The RNA quantity and quality were assessed through NanoDrop® ND-2000 Spectrophotometer (Waltham, MA, USA). To evaluate transcript changes, 1000 ng of total RNA was reverse-transcribed to cDNA using the "High Capacity cDNA Reverse Transcription Kit" (Applied Biosystems, Carlsbad, CA, USA).
The following TaqMan gene expression assays (Applied Biosystems, Carlsbad, CA, USA) were used to detect and quantify genes using the Viia7 DX real time PCR instrument (Life Technologies, Waltham, MA, USA): TRAF-6 (Rn00590197_m1), Atrogin-1 (fbx32) (Rn00591730_m1), and GAPDH (Rn01462661_g1).
4
Real-time RT-qPCR analysis of RLMNL1-3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand cDNA was synthesized from 1 μg of DNase I-treated total RNA using Reverse Transcriptase M-MLV (TaKaRa). RT-qPCR was performed using UltraSYBR Mixture with ROX (CWBIO) on a ViiA 7 Dx Real-time PCR instrument (Applied Biosystems). All samples were analyzed in triplicate. ACTIN2 (AT3G18780) and TUBULIN4 (AT5G44340) were used as reference genes for measuring the expression of RLMNL1-3. The relative expression levels were calculated via 2−△△CT. All primers used were listed in Supplementary Table 1 .
5
Quantification of IL-15 Expression in Splenic Leukocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from splenic leukocytes using TRIZOL reagent (GIBCO BRL) according to manufacturer’s instructions. cDNA was reverse transcribed from 500 ng of total RNA in a 20-μl reaction using first strand cDNA synthesis kit (Thermo Scientific). For quantification of β-actin and IL-15 genes by real-time PCR, one-tenth volume of cDNA was added to a 15-μl reaction of FastStart Universal Probe Master Kit (Roche) and amplified using ViiA 7 Dx real-time PCR Instrument (Applied Biosystems). Expression of IL-15 in all the samples was normalized to β-actin levels. The primer sequences for β-actin are forward: 5′CCAACCGTGAAAAGATGAC3′ and reverse: 5′GTACGACCAGAGGCATACAG3′, for IL-15 are forward: 5′ACATCCATCTCGTGCTACTTGT3′ and reverse: 5′GCCTCTGTTTTAGGGAGACCT3′ (27 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!