The largest database of trusted experimental protocols

2 protocols using pcr kit rr036a and rr420a

1

Detailed Protocol for qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
FG-4592 was purchased from Cayman Chemical Company (www.caymanchem.com), and normal saline (NS) was obtained from Changhai Hospital (Shanghai, China). The apoptosis detection kit was purchased from TransGen (Beijing, China). The PCR kit (RR036A and RR420A) was purchased from TAKARA (Japan). RPMI 1640, DMEM and fetal bovine serum (FBS) were supplied by Gibco (New York, USA). Organoid cultures were obtained from STEM CELL. BCL2, BAX, C-CASPASE3, GAPDH, NF-κB and P-IKK-β antibodies were supplied by CST. The TLR4 antibody was supplied by Proteintech. In Situ Cell Death Detection Kit was obtained from Roche (Basel, Switzerland). The primes were obtained from Shenggong Biotech (Shanghai, China). The list of primers is shown in Table 1.

qRT-PCR primers for the eight genes evaluated

Gene symbolForwardReverse
TLR4AAATGCACTGAGCTTTAGTGGTTGGCACTCATAATGATGGCAC
IL-6CTGCAAGAGACTTCCATCCAGAGTGGTATAGACAGGTCTGTTGG
IGFBP2CAGACGCTACGCTGCTATCCCCCTCAGAGTGGTCGTCATCA
SOX2GCGGAGTGGAAACTTTTGTCCCGGGAAGCGTGTACTTATCCTT
REG2CTGATGTTCCTGTCATACAGCCCCAGGTCAAACGGTCTTCAATTA
REG3BACTCCCTGAAGAATATACCCTCCCGCTATTGAGCACAGATACGAG
REG3DGACTCCATGATCTGTCACTTGGCATAGGGAAATGTTGGGTCACAA
HK1CAAGAAATTACCCGTGGGATTCACAATGTTAGCGTCATAGTCCCC
+ Open protocol
+ Expand
2

Organoid-based Intestinal Barrier Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
APS was purchased from Shanghai Yuanye Biological Technology Company (Shanghai, China). Normal saline (NS) was obtained from ChangHai Hospital (Shanghai, China) and PBS buffer was purchased from Hyclone company (New York, USA). RPMI 1640 medium and fetal bovine serum (FBS) were provided by Gibco (New York, USA). IntestiCult™ Organoid Growth Medium (06005) and Matrigel (356231) were purchased from Stem Cell Technologies (Canada). FITC‐dextran was purchased from Sigma‐Aldrich (Saint Louis, USA). 2‐Methoxyestradiol (2‐MeOE2) was supplied by Selleck Chemicals (Houston, USA). The apoptosis detection kit (FA101) was purchased from Transgen (Beijing, China). The PCR kit (RR036A and RR420A) was purchased from TAKARA (Japan). The CCK8 kit (CK04) was obtained from Donjindo (Osaka, Japan). The cytometric bead array (CBA) (740446) was purchased from Biolegend (USA). BCL2, BAX, C‐CASPASE3, ZO‐1, Occludin, AKT1, OLFM4, Axin, Hif‐1α, β‐actin and GAPDH antibodies were supplied by Cell Signalling Technology (Massachusetts, USA). The primes were supplied by Shenggong Biotech (Shanghai, China). The list of primers is shown in Table 1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!