Pmetluc2 control

Manufactured by Takara Bio

Sourced in Japan

The PMetLuc2-Control is a control plasmid designed for use with the PMetLuc2 reporter system. It expresses the Metridia luciferase (MetLuc) reporter gene under the control of a constitutive promoter, providing a positive control for MetLuc expression and assays.

Automatically generated - may contain errors

Lab products found in correlation

Pmcherry c1, by Takara Bio (3 mentions) Glutamax, by Thermo Fisher Scientific (2 mentions) In fusion hd ecodry cloning kit, by Takara Bio (2 mentions) Sanger dna sequencing, by Eurofins (1 mentions) Pegfp n1, by Takara Bio (1 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions) Pureyield plasmid midiprep system, by Promega (1 mentions)

Close spelling variants of this product

PMetLuc2 (4 citations)

4 protocols using pmetluc2 control

Generating Aptamer-Functionalized Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmids pmCherry-C1 and pMetLuc2-Control were purchased from Takara Clontech (Kyoto, Japan). pmCherry-PAL and pMetLuc plasmids with aptamers in the 5’UTR were generated using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech, Kyoto, Japan). Previous PCR amplification used the primer pair:

5’- CTCAAGCTTCGAATTCATGAAGGTGAACCGGCCC 3’

5’- TAGATCCGGTGGATCCCTACGACGCCAGCTGCTCCAA 3’

pmCherry-C1 was linearized using EcoRI and BamHI. Primers for the aptamer inserts were:
Primers for the linearized pMetLuc2-Control plasmid were:
HeLa cells (CLS Cell Lines Service GmbH, Eppelheim, Germany) were cultured in DMEM medium (high glucose, GlutaMAXTM, Thermo Fisher Scientific, Darmstadt, Germany) supplemented with 10% fetal calf serum (FCS, Sigma-Aldrich, St. Louis, Missouri, USA) at 37ºC and 5% CO₂, and were passaged every 2 to 3 days.

Weber A.M., Kaiser J., Ziegler T., Pilsl S., Renzl C., Sixt L., Pietruschka G., Moniot S., Kakoti A., Juraschitz M., Schrottke S., Bryant L.L., Steegborn C., Bittl R., Mayer G, & Möglich A. (2019). A blue light receptor that mediates RNA binding and translational regulation. Nature chemical biology, 15(11), 1085-1092.

+ Open protocol

+ Expand

Plasmid-based miRNA and shRNA cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

All oligonucleotides were purchased from Ella Biotech, Planegg, Germany. Plasmid pIRESneo-FLAG/HA Ago2 was kindly provided by Thomas Tuschl. The plasmids pmCherry-C1, pMetLuc2-Control and peGFP-N1 were purchased from Takara Clontech. All miR and shRNAs described herein were cloned in the pSilencer 2.0-U6 plasmid backbone using restriction cloning. Corresponding miR and shRNA sequences are listed in Supplementary Table 1. The identity of all constructs was confirmed by Sanger DNA sequencing (Eurofins).

Pilsl S., Morgan C., Choukeife M., Möglich A, & Mayer G. (2020). Optoribogenetic control of regulatory RNA molecules. Nature Communications, 11, 4825.

+ Open protocol

+ Expand

Generating PXR mutant expression plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length human PXR [76 (link)] and CYP3A4 enhancer/promoter reporter gene plasmid pGL4-CYP3A4 (7830Δ7208-364) [77 (link)] have been described previously. Metridia luciferase expression plasmid pMetLuc2control was obtained from Takara-Clontech (Mountain View, CA, USA). Site-directed mutagenesis of the full-length PXR expression plasmid with suitable oligonucleotides designed with NEBaseChanger using Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) was utilized to generate PXR mutants Q285A, Y306A, S247A, H407A, W223A, F281A, W299A, and F429A. The mutations were confirmed by sequencing. Plasmids were purified using PureYield Plasmid Midiprep System (Promega, Madison, WI, USA).

Rashidian A., Mustonen E.K., Kronenberger T., Schwab M., Burk O., Laufer S.A, & Pantsar T. (2022). Discrepancy in interactions and conformational dynamics of pregnane X receptor (PXR) bound to an agonist and a novel competitive antagonist. Computational and Structural Biotechnology Journal, 20, 3004-3018.

+ Open protocol

+ Expand

Generating Aptamer-Functionalized Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

5’- CTCAAGCTTCGAATTCATGAAGGTGAACCGGCCC 3’

5’- TAGATCCGGTGGATCCCTACGACGCCAGCTGCTCCAA 3’

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!