Sybr premix ex taq 2 dna polymerase

The RNA extraction was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Equal amounts of total RNA (2 μg) were used to synthesize cDNA using the PrimeScript RT Master Mix (TaKaRa). Gene expressions were analyzed by quantitative reverse transcription-PCR (qPCR) with Applied Biosystems QuantStudio 6&7 (Applied Biosystems, Grand Island, NY, USA) using SYBR Premix Ex Taq II DNA polymerase (TaKaRa). Specific primers used for IFN-β, IFIT1, and CXCL10 were used for real-time PCR: Sus scrofa IFN-β forward primer, 5′- AACCACC ACAATTCCAGAGGG -3′, reverse primer 5′- GGTTTCATTCCAGCCAGTGC -3′, Sus scrofa IFIT1 forward primer, 5′- TCAGAGGTGAGAAGGCTGGT -3′, reverse primer 5′- GCTTCCTGCAAGTGTCCTTC-3′, Sus scrofa CXCL10 forward primer, 5′-TTCGCTGTACCTGCATCAAG-3′, reverse primer 5′-CAACATGTGGGCAAGA TTGA-3′. The data were analyzed by The QuantStudio 6 and 7 Flex Real-Time PCR System Software.

Total RNA was extracted by TRIzol (Invitrogen, Carlsbad, CA, USA), and 500 ng of total RNA was reverse-transcribed into complementary DNA by using PrimeScript RT Master Mix (TaKaRa) according to the respective manufacturer’s protocol. The mRNA levels of beclin1 and lc3 were measured by quantitative PCR (q-PCR) with an Applied Biosystems QuantStudio 6&7 (Applied Biosystems, Grand Island, NY, USA) using SYBR Premix Ex Taq II DNA polymerase (TaKaRa), and GAPDH gene expression was used as the endogenous control. Specific primers used for beclin1 and lc3 were used for real-time PCR: Sus scrofa beclin1 forward primer, 5′- CTGAAGAGTGTAG AAAACCAGATGC -3′, reverse primer 5′- CCAGCCTGAAGTTATTGATTGTG -3′, S. scrofa lc3 forward primer, 5′- AACTAAGCTGTCTCTGCCCC -3′, reverse primer 5′- ACTGGGCCAGAATCCATCCA-3′. All samples were sequenced three times, and experiments were repeated three times.

The total RNA of lungs from the different group were extracted using TRIzol (Takara, Osaka, Japan), these RNA concentrations were quantified by spectrophotometer Biophotometer B500 (METASH, Shanghai, China), and 1 µg of RNA was reversed transcription into cDNA with the One-Step RT-PCR Kit (Takara, Osaka, Japan). The reaction system (final volume of 30 µL) included 15 µL of 2× RealStar Green Fast Mixture (GenStar, Beijing, China), 2 µL cDNA, 2 µL corresponding primers, and 11 µL of DEPC water. Quantitative PCR (qPCR) analyses were performed on a CFX Connect real-time PCR system (Bio-Rad) using SYBR Premix Ex Taq II DNA polymerase (Takara, Osaka, Japan). The following thermocycling conditions were used for qPCR: initial denaturation at 95 °C for 5 min; 40 cycles at 95 °C for 10 s; 60 °C for 30 s; 72 °C for 20 s. The expressions of IL-6, IL-1β, IFN-γ, and TNF-α were normalized against those of GADPH by the 2^−ΔΔCT threshold cycle (CT) method. All test samples were run in three independent experiments, and these primers are presented in Table 1.