Ez1 rna tissue mini kits 48

Total RNA was isolated from the tumor specimens using the BIO ROBOT EZ1 and EZ1 RNA Tissue Mini Kits (48) (both Qiagen) according to the manufacturer’s instructions. Subsequently, the total RNA was converted to cDNA using oligo-p(dN)6 random primers and Superscript II reverse transcriptase (both Life Technologies). Of note, β-actin was used as an internal standard to assess the quality of the RNA isolation. The cDNAs were measured with respect to the threshold cycle number (Ct) of β-actin, and less than 28 cycles were subsequently performed to determine the expression levels of KK-LC-1. The expression of KK-LC-1 was examined using conventional reverse transcription polymerase chain reaction (RT-PCR), due to the lack of an appropriate probe for detection of KK-LC-1 mRNA. For the RT-PCR of KK-LC-1, specific primers were used (forward: ATGAACTTCTATTTACTCCTAG CGAGC and reverse: TTAGGTGGATTTCCGGTGAGG), and annealing was performed at 67 °C for 40 cycles, yielding a 342-bp product.

Total RNA was isolated from the tumor specimens using the BioRobot^® EZ1™ and EZ1 RNA Tissue Mini Kits (48) (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and then converted to cDNA using oligo-p(dN)₆ random primers and Superscript™ II reverse transcriptase (Life Technologies). β-Actin was used as an internal standard to assess the quality of the isolated RNA in which the expression of the CTAs, including KK-LC-1, was evaluated. The expression levels of ACTB (β-actin), MAGE-A1, MAGE-A3, and NY-ESO-1 were measured with TaqMan^® Gene Expression Assays, ID numbers Hs99999903_m1, Hs00607097_m1, H200366532_m1, and Hs00265824_m1, respectively, using a 7900HT Fast Real-Time PCR system (Life Technologies). For cDNAs for which expression [represented by threshold cycle number (Ct)] of the ACTB gene yielded a Ct of < 28, the expression of KK-LC-1 was examined using endpoint reverse transcription PCR (RT-PCR) rather than a probe-based assay, as an appropriate probe for detecting KK-LC-1 mRNA has not been established. For RT-PCR of KK-LC-1, the oligonucleotides 5’-ATGAACTTCTATTTACTCCTAGCGAGC-3’ and 5’-TTAGGTGGATTTCCGGTGAGG-3’ were used as specific primers, and annealing was performed at 67 °C for 40 cycles, yielding a 342-base pair product. The intensity of KK-LC-1 positive- or negative-amplicon was shown in Figure 1.