Hot firepol evagreen

SH‐SY5Y cells were seeded in six‐well plates and differentiated into a neuron‐like phenotype with retinoic acid as previously described (Teppola et al., 2016 (link)). Differentiated SH‐SY5Y cells were harvested using TRIzol (Invitrogen) followed by RNA extraction using Direct‐zol miniprep (Zymo Research), according to the manufacturer's instructions. Three biological replicates were processed for each time point. RNA was extracted at 48‐hr intervals using TRIzol reagent (Invitrogen, CA, USA) and Direct‐zol RNA miniprep (Zymo Research, CA, USA) according to the manufacturer's instructions. Total RNA was converted to cDNA using the superscript VILO cDNA synthesis kit (Invitrogen) following the manufacturer's instructions. RT‐qPCR was performed on the QuantStudio 6 Flex system for AS3MT^full, AS3MT^d2d3 transcripts, and the endogenous controls β‐Actin and GAPDH with HOT FIREPol EvaGreen (Solis Biodyne, Estonia). Primer information for RT‐qPCR is listed in (Table S1). The relative expression of the two isoforms was calculated using the delta delta CT. Statistical analysis across time was performed by a one‐way ANOVA and pairwise t‐test post hoc analysis. Data are presented as a mean fold change relative to baseline (zero‐day) samples, error bars are ±SEM, n = 3 per timepoint.

DNA was isolated from peripheral blood cells via a salting-out procedure. The primers were designated using Oligo 7.6 software (DBA Oligo, Inc., Colorado Springs, CO). The NC_000008.10:g.128413305 G>T polymorphism DNA fragment (170 bp) was amplified using the primers (forward 5′ TAACCTCTTCCTATCTCA 3′ and reverse 5′ AAATAAAGTCAATAGCACAT 3′). The rs6983267 SNP was then genotyped via high-resolution melting (HRM) curve analysis using HOT FIREPol EvaGreen (Solis BioDyne, Tartu, Estonia) with a LightCycler 480 system (Roche Diagnostics, Mannheim, Germany). The presence of this SNP was reanalyzed by Sanger sequencing analyses of arbitrarily chosen samples, comprising 10% of the samples from both cases and controls. The concordance rate between HRM and sequencing was 100%.