The largest database of trusted experimental protocols

Takara genomic dna extraction kit

Manufactured by Takara Bio
Sourced in China

The TaKaRa Genomic DNA Extraction Kit is a laboratory equipment designed for the extraction and purification of genomic DNA from various biological samples. It provides a reliable and efficient method for obtaining high-quality genomic DNA suitable for downstream applications.

Automatically generated - may contain errors

3 protocols using takara genomic dna extraction kit

1

Bisulfite-Based DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA extraction was performed using the TaKaRa Genomic DNA Extraction Kit (TaKaRa Co., Dalian, China). Genomic DNA (2 ug per sample) was bisulfite modified with the Epitect Bisulfite Kit Protocol (Qiagen), and the modified DNA was amplified using the following primers: BSQ1 forward, 5′-gaaggatttcggttaatttgggg-3′, and reverse, 5′-caaactcgccaaataactacctacg-3′; and BSQ3 forward, 5′-ggttgattatttgaggttaggtgtt-3′, and reverse, 5′-aaaacaattttcaaccaaccatc-3′. The modified DNA was amplified by PCR using 0.2 µM of each primer, 2 units of Hot Start Taq DNA polymerase, and 0.2 mM of each dNTP per reaction. Cycling programs were 95°C for 10 minutes, and then 40 cycles of 95°C for 30 seconds, 54°C for 30 seconds, and 72°C for 30 seconds, followed by a 5-minute incubation at 72°C. The PCR products were examined by gel electrophoresis in 1.5% agarose to confirm that a single band had been obtained and were then sequenced by Invitrogen. Methylation-specific PCR (MS-PCR) was carried out on bisulfate-treated DNA. The primers used were Un-methylated KLF4 forward, 5′-ggttgattatttgaggttaggtgttt-3′, and reverse, 5′-cccaaataacaaaaattacaaacat-3′; and Methylated KLF4 forward, 5′- gttgattatttgaggttaggtgttc-3′, and reverse, 5′-cgaataacgaaaattacaaacgta-3′. Umbilical cord blood DNA was used as a negative control, and it was methylated in vitro by using the Sss1 (CpG) methylase (New England Biolabs).
+ Open protocol
+ Expand
2

OLFM4 Promoter Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from HGC27, SGC-7901 and MGC-803 cells with the TaKaRa Genomic DNA Extraction Kit (TaKaRa Co., China). Genomic DNA (1 μg per sample) was modified with bisulfite using the Epitect Bisulfite Kit Protocol (Qiagen) following the manufacturer's instructions, and the modified DNA was amplified using the following primers: OLFM4 forward, AAAGGTGTGTGAAATGTTGAG, and reverse, CTCTCCCCCATTTTACT. The PCR products were gel extracted (Qiagen) to confirm that a single band had been obtained and were then sequenced by Invitrogen.
+ Open protocol
+ Expand
3

Quantifying Cerebral mRNA Expressions

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA expressions of AQP4 and AQP9 in the discrete cortex, and mRNA expressions of intercellular cell adhesion molecule-1 (ICAM-1) and nuclear factor-κB (NF-κB) in the hippocampus were determined by qPCR. Total RNA was extracted from the discrete cortex or hippocampus (n=6 rats per group at each time point) using a Takara Genomic DNA Extraction Kit (TaKaRa Bio, Inc., Shiga, Japan) at 6, 24, and 72 h after reperfusion. Extracted total RNA was then reverse transcribed to generate cDNA. The reverse transcription reaction was then amplified using SYBR Green qPCR system (TaKaRa Bio Inc.). The fold change in relative mRNA expression was determined using the 2−ΔΔCt method and β-actin as an internal control [19 (link)]. All the forward and reverse primers used in the study were shown in Table 1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!