Total nucleic acids were extracted from the serum and EDTA-blood samples using MagNA Pure LC instrument and Total Nucleic acid kit (Roche, Espoo, Finland). Total nucleic acid templates were used for nsP2-RT-qPCR and nested RT-PCR, both described below. For the processing of the nsP2-RT-qPCR reaction mixtures and total nucleic acid templates, QIAgility (Qiagen, Hilden, Germany) automated system was also used.
Total nucleic acid kit
Manufactured by Roche
Sourced in Germany
The Total Nucleic Acid Kit is a lab equipment product designed to extract and purify total nucleic acids, including DNA and RNA, from various sample types. It provides a reliable and efficient method for nucleic acid isolation without bias.
Automatically generated - may contain errors
Lab products found in correlation
Magna pure lc instrument, by Roche (2 mentions)
Magna pure lc, by Roche (2 mentions)
Qiagility, by Qiagen (1 mentions)
Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Qiaamp 96 dna blood kit, by Qiagen (1 mentions)
Floqswab, by Copan (1 mentions)
Chromo4 machine, by Bio-Rad (1 mentions)
6 protocols using total nucleic acid kit
1
Automated Extraction of Total Nucleic Acids
2
Adenovirus Detection via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nasopharyngeal swabs (FLOQSwabs™, Copan Diagnostics, Corona, CA) were obtained on the day of enrollment and processed by adenovirus‐specific PCR via two methods. Samples received prior to October 11, 2010 were extracted using the QIAamp 96 DNA Blood Kit (Qiagen, Venlo, the Netherlands). Samples received after that date were extracted on the MagNA Pure LC 2·0 instrument using the Total Nucleic Acid kit (Roche Diagnostics, Basel, Switzerland). Adenovirus detection and typing was done using the Applied Biosystems 7500 Fast Real‐Time PCR system (Life Technologies, Carlsbad, CA) using a laboratory‐developed adenovirus real‐time PCR assay that targets the penton region. This assay has been validated against a previously described, CAP‐accredited PCR assay (Appendix 1 ).12 Adenovirus‐positive samples were subsequently tested by a multiplex diagnostic panel (Diatherix TEM‐PCR; Diatherix Laboratories, Inc.; Huntsville, AL) that included primers for common viral respiratory pathogens, including adenovirus, influenza, parainfluenza, rhinovirus, coronavirus, respiratory syncytial virus, human metapneumovirus, and Coxsackie virus.
3
Quantification of Viral RNA in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the relative amount of viral RNA in the respective tissues, viral RNA was extracted from the heart, liver, spleen, lung, kidney, and brain samples using the automated Magna Pure method and a Total Nucleic Acid Kit (Roche Diagnostics), following the manufacturer’s instructions. CHIKV RNA was detected with specific TaqMan probes by using one-step RT-PCR (Master RNA hybridization probes, Roche), performed on a Chromo 4 machine (Bio-Rad). The primers and probes used for CHIKV RNA quantification were CHIKV-forw AAGCTCCGCGTCCTTTACCAAG; CHIKV-rev CCAAATTGTCCTGGTCTTCCT; and Probe: Fam-CCAATGTCTTCAGCCTGGACACCTTT-BHQ1 (29 (link)). For absolute quantification, standard curves were generated using 10-fold dilutions of CHIKV Ross RNA templates of known concentration (tittered in Vero cells by TCID50). Based on repeated standard curves, the formula was obtained: y=-3.641x+31.76 (y means CT, x means index). The extracted viral RNA from tissues were used to obtain the CT number using qRT-PCR. Weight of each tissue was measured prior to extraction. From these known data, the results were calculated and expressed as TCID50 per gram of tissue (30 (link)).
4
Pneumococcal Serotype Identification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The nasopharyngeal samples were transported frozen to Sweden where DNA was extracted from 200 μL of the Liquid Amies medium using the MagNA Pure LC instrument (Roche Diagnostics, Mannheim, Germany) and the Total Nucleic Acid Kit (Roche Diagnostics). After the extraction, the eluted nucleic acids (100 μL) were diluted 1:2 with RNase-free water. All samples were first analyzed by a single-target polymerase chain reaction (PCR) for the “Xisco” gene, a reliable marker for pneumococcal identification (11–13 (link)). Results with a Cycle threshold (Ct) value <40 were considered positive. Positive samples were further analyzed for identification of pneumococcal serotypes or groups by a multiplex real-time PCR protocol based on sequences published by Centers for Disease Control and Prevention (CDC) and developed in-house as previously described (14 (link)). This protocol also included detection of the pneumococcal capsule cpsA gene. In summary, the assay could detect all VTs included in the PCV13, namely, 1, 3, 4, 5, 6ABCD, 7FA, 9AV, 14, 18, 19A, 19F and 23F, and the following NVTs 2, 7 BC/40, 8, 9NL, 10A, 11 AD, 12AF/44/46, 15 BC, 17F, 20, 22AF, 25AF/38 and 33AF/37. Since there is evidence of cross-protection with vaccine-related serotypes (15 (link)), a possible 6CD, 7A, 9A and 18 non-C was considered VTs in the analysis although not included in the PCV13.
5
Nasopharyngeal Swab Nucleic Acid Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nasopharyngeal swab solution (180 µL) was mixed with 20 µL PBS 10 ×. This volume was used for extraction of total nucleic acid using the MagNA Pure LC instrument (Roche Diagnostics, Mannheim, Germany) and the Total Nucleic Acid Kit (Roche Diagnostics) according to manufacturer’s instruction. The nucleic acids were eluted in 100 µL and of these, 5 µL was used for each polymerase chain reaction (PCR) assay.
6
Automated RNA Extraction from Swab Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A swab suspension of 200 µl was processed using the automated MagNA Pure LC with the Total Nucleic acid kit (Roche), and eluted in 100 µl.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!