Nucleospin rna kit

Total RNA was isolated using a NucleoSpin RNA kit (Macherey Nagel, Duren, Germany, 740955) according to manufacturer’s protocol. Total RNA was isolated using a NucleoSpin RNA kit (Macherey Nagel, Duren, Germany, 740955) according to manufacturer’s protocol. RNA was reverse transcribed using RevertAid RT Reverse Transcription Kit (ThermoFisher Scientific, Landmeer, The Netherlands, K1691). Generated cDNA was amplified with primer pairs for the indicated gene, using the CFX Connect Real-Time PCR Detection System (Bio-Rad). GAPDH was used as housekeeping gene. Quantification was performed relative to the levels of the GAPDH and normalised to control conditions. The data analysis was performed using the 2^−ΔΔCt method1. Primer sequences: BMPR2 forward AACTGTTGGAGCTGATTGGC reverse CGGTTTGCAAAGGAAAACAC. GAPDH forward AGCCACATCGCTCAGACAC reverse GCCCAATACGACCAAATCC.

Five second-instar larvae per sample were homogenized and RNA was extracted using Nucleospin RNA kit (Macherey-Nagel) according to the manufacturer’s protocol. For fat body-specific analysis, third-instar non-wandering larvae were raised on HPD and acutely exposed to HSD (or HPD for control), after which fat bodies from 3 larvae per sample were dissected and RNA was extracted with Nucleospin RNA kit (Macherey-Nagel) according to the manufacturer’s protocol. Reverse transcription was performed with equal amount of RNA (RevertAid H Minus First Strand cDNA Synthesis Kit, Thermo Scientific). qRT-PCR experiment was conducted using Maxima SYBR Green qPCR Master Mix (2X) (Fermentas) in the Light cycler 480 Real-Time PCR System (Roche). See Supplementary Table 5 for primer sequences.

Total RNA was extracted from NSC-34 cells and motoneurons using the NucleoSpin RNA kit (Macherey-Nagel). For mouse tissue, samples were collected in microcentrifuge tubes and immediately snap-frozen by immersion in liquid nitrogen. Samples were kept at −80 °C until processing. Tissues were ground with mortar and pestle and RNA was isolated using the NucleoSpin RNA kit (Macherey-Nagel, 740955.50).

Infectious viral titers and viral RNA levels were, respectively, quantified with the Reed & Muench TCID50 assay and quantitative reverse-transcription PCR (RT-qPCR) tests. The titration of live infectious virus was performed as follows. Tissue was homogenized in Lysing Matrix D tubes containing 1 mL of PBS, using the mixer mill MM 400 (Retsch, Haan, Germany) (15 min, 15 Hz). After centrifugation at 15,000× g for 5 min, the clarified supernatant was harvested for live virus titration. For the TCID50 assay, the supernatant was serially diluted in DMEM containing 1% penicillin/streptomycin, and the dilutions were transferred onto Vero E6 cells on 96-well plates. Briefly, serial 10-fold dilutions of each sample were inoculated onto a Vero E6 cell monolayer in duplicate and cultured in DMEM supplemented with 2% fetal bovine serum (Invitrogen, Waltham, MA, USA) and 1% penicillin/streptomycin and L-glutamine. The cultures were observed for cytopathic effects daily for 5 or 6 days. Viral RNA in the lung tissue was quantified as follows. Briefly, the tissue was homogenized in 1 mL of RA1 buffer from the NucleoSpin RNA Kit, containing 20 mM of tris(2-carboxyethyl) phosphine (Macherey Nagel, Hoerdt, France). Total RNA in the tissue homogenate was extracted with the NucleoSpin RNA Kit (Macherey Nagel, Hoerdt, France) and eluted in 60 µL of water.

Sequences of selected differentially expressed circRNAs were obtained from circBase [111 (link)] and CircInteractome [101 (link)]. Designed divergent qPCR oligos are listed in Table S1. For qPCR, RNA was preferably isolated using the NucleoSpin RNA Kit (Macherey-Nagel, Düren, Germany). Otherwise, if RNA had been isolated by TRIzol (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA), the RNA was then treated on column using DNA digestion step from NucleoSpin RNA Kit (Macherey-Nagel, Düren, Germany). One µg RNA was used for cDNA synthesis using First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). qPCR was done with Sso Fast Eva Green Mix (Bio-Rad, Hercules, CA, USA) using 0.5 µM forward and 0.5 µM reverse primer and cDNA from 10 ng RNA as template. qPCR was run on a CFX96 cycler (Bio-Rad) using the standard program as given in the SsoFast EvaGreen SuperMix manual. Data were evaluated using the ∆∆Ct method with GAPDH or RPL32 as reference mRNA for normalization.

RNA extraction from mammalian cells were performed with TRIzol reagent (Life Technologies, Thermo Fisher Scientific, Waltham, Massachusetts, USA) or NucleoSpin RNA Kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s protocol. To isolate RNA from tissues, mouse tissue was mechanically disrupted using FastPrep-24 (MP Biomedicals, Santa Ana, CA, USA) with lysing matrix D containing 1mL TRIzol reagent. The program was set for 45 s at 6.5 m/s. Afterwards, the ceramic beads in TRIzol were incubated at RT for 5 min and then following the TRIzol manual. RNA extraction from the cell lysates was collected in TRIzol-LS reagent (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) following the TRIzol-LS manual.
RNA treatment with RNase R was performed using RNase R (Biozym Hessisch Oldendorf, Germany) according to the manufacturer’s protocol. The reaction was cleaned up using NucleoSpin RNA Kit (Macherey-Nagel, Düren, Germany).

Blood samples for plasma collection (EDTA and heparinized blood) and peripheral blood mononuclear cell (PBMC) harvesting (Cell Preparation Tubes (CPT), Becton Dickinson, Franklin Lakes, NJ) were taken directly at presentation. PBMCs were isolated according to the manufacturer’s instructions and preserved in RA1 lysis buffer for later RNA extraction (Nucleospin RNA kit, Macherey-Nagel, Dueren, Germany) or viably frozen (see flow cytometry) awaiting additional analysis. Alveolar macrophages (AMs) were isolated from BAL fluid using CD71 MACS beads (Miltenyi Biotec, Bergisch Gladbach, Germany) as described [14 (link)]. In brief, BAL fluid was centrifuged and cells were resuspended in ice-cold sterile automated magnetic cell sorting and separation (autoMACS) buffer (PBS, 0.5% bovine serum albumin, 2 mM EDTA; pH = 7.4). Subsequently, cells were incubated for 15 min with CD71 microbeads at 4°C. Cells were washed again in autoMACS buffer and purified by autoMACS (Multenyi Biotec). The average AM purity was 96% as determined on cytospins. AMs were preserved in RA1 lysis buffer for RNA analysis (Nucleospin RNA kit, Macherey-Nagel, Dueren, Germany).