Taqman microrna reverse transcription kit
The TaqMan MicroRNA Reverse Transcription Kit is a laboratory product designed to enable the reverse transcription of microRNA molecules. It provides the necessary reagents and protocols for the conversion of microRNA into complementary DNA (cDNA) for subsequent analysis and quantification.
Lab products found in correlation
2 952 protocols using taqman microrna reverse transcription kit
miRNA and mRNA Expression Analysis
Quantifying miRNA Expression Using RT-qPCR
Total RNA Isolation and Gene Expression Quantification
Quantitative miRNA-124a Expression Analysis
Multiplex RT-qPCR for Rodent miRNA
Quantification of Regulatory RNA Transcripts
Primers and probes used for RT-qPCR
Primer or Probe | Gene | Sequence (5′- > 3′) or Assay ID |
---|---|---|
Primer | MIR17HG | F:TCAGGAGTTCGAGACCAACC |
R:TGCCTCAGCCTCCAGAGTAG | ||
FOXR2 | F:CTGTGAACCCAATCTGTGGA | |
R:GGCTGAGGGAAAGGAGAAAT | ||
GAPDH | F: ACAGTCAGCCGCATCTTCTT | |
R: GCCCAATACGACCAAATCC | ||
Probe | MiR-153 | rs180704631 |
MiR-377 | rs774685804 | |
U6 | 001973(Applied biosystems) |
Quantification of microRNA Levels with qPCR
Quantitative Analysis of CASC11 and miRNA-182
Quantifying miRNA in Liver Cancer Cells
Circulating miRNA was extracted from 200 µl of serum samples using the Qiagen miRNeasy serum-plasma kit (Qiagen K.K.) according to the instructions provided by the manufacturer. RNA was reverse-transcribed using the TaqMan MicroRNA Reverse Transcription kit (Life Technologies Japan) following the manufacturer's instructions. Caenorhabditis elegans miR-39 (cel-miR-39) was spiked in each sample as a control for the extraction and amplification steps. Serum miRNA was amplified using primers and probes provided by Applied Biosystems by the TaqMan MicroRNA assay, according to the instructions provided by the manufacturer. The relative expression of serum miRNA was calculated using the comparative cycle quantification (Cq) method (2−ΔΔCq) (18 (link)) with spiked cel-miR-39 as a normalized internal control.
Reverse Transcription of miR-21 and snoRNA202
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!