Datasets and sample sources used in transcriptome analyses are listed in supplemental Table 1 . Cell line RNA was isolated using Qiagen RNAeasy (Qiagen). RNA sequencing libraries were prepared using Stranded mRNA kit (Illumina). Sequencing (150 bp, paired end) and analysis was performed by Genewiz. Normal T-cell RNA sequencing data paired to ATAC-seq for normal T cells were obtained from GSE118165 .21 (link) For both cell line and normal T-cell samples, sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36. The trimmed reads were mapped to the Homo sapiens GRCh38 reference genome using the STAR aligner v.2.5.2b. Unique gene hit counts were calculated by using featureCounts from the Subread package v.1.5.2. Comparison of gene expression between sample groups was performed using DESeq2, and the Wald test was used to generate P values and log2 fold changes. RNA isoforms were visualized in IGV software (Broad Institute). NA-ATLL patient and normal donor peripheral blood mononuclear cell (PBMC) RNA-sequencing data were previously published,8 (link) and differential analysis was performed using DESeq2. J-ATLL and normal CD4 T cell microarray data were accessed through GSE33615 ,29 (link),30 (link) and data were analyzed using GEO2R.
Rnaeasy
Manufactured by Qiagen
Sourced in Germany, United States, Netherlands
The RNAeasy is a lab equipment product designed for the isolation and purification of RNA from a variety of biological samples. It provides a simple and efficient method for extracting high-quality RNA for use in downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (16 mentions)
Iscript cdna synthesis kit, by Bio-Rad (10 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (8 mentions)
Superscript 3, by Thermo Fisher Scientific (7 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (6 mentions)
Nanodrop, by Thermo Fisher Scientific (5 mentions)
Bioanalyzer, by Agilent Technologies (4 mentions)
Superscript 2, by Thermo Fisher Scientific (4 mentions)
Rnaeasy kit, by Qiagen (3 mentions)
Rnalater, by Thermo Fisher Scientific (3 mentions)
Superscript choice system, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Qiashredder, by Qiagen (3 mentions)
Qscript reverse transcription kit, by Quantabio (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Sybr green, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Turbo dnase, by Thermo Fisher Scientific (3 mentions)
Trypsin edta, by Thermo Fisher Scientific (3 mentions)
Agilent bioanalyzer, by Agilent Technologies (2 mentions)
153 protocols using rnaeasy
1
Transcriptome Analysis of T-cell Samples
2
qPCR Analysis of ETS1 and CCR4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Qiagen RNAeasy (Qiagen) and reverse transcribed to cDNA using SuperScript III First-Strand Synthesis SuperMix (Invitrogen). qPCR was performed using EvaGreen qPCR Mastermix (Applied Biologic materials Inc) with the following primer sequences: ETS1 forward: GGCAGTTTCTTCTGGAATTA, ETS1 reverse: CACGGCTCAGTTTCTCATA42 (link); CCR4 forward: CTCTGGCTTTTGTTCACTGCTGC, CCR4 reverse: AGCCCACAGTATTGGCAGAGCA (Origene), ACTB forward: CATCCTGCGTCTGGACCT, ACTB reverse: TAATGTCACGCACGATTTCC.43 (link) Results were normalized using ACTB and relative fold change was calculated using the ΔΔCt method.
3
Quantitative RT-PCR Analysis of Adipocyte Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured 3T3-L1 adipocytes or iBAT was isolated using Qiazol (Qiagen) method combined with Qiagen RNAEasy minicolumns, according to the manufacture's instructions. Equal amounts of RNA were retro-transcribed to cDNA using cDNA synthesis kit (Bio-Rad). The resultant cDNA was used in quantitative PCR reactions containing SYBR-green fluorescent dye (Bio-Rad). UCP1 relative expression levels were calculated using the 2−ΔCt method. TATA-binding protein (TBP) or 36B4 expression was used for normalization. Target primer sequences are shown in Table 1 .
RT-PCR primer sequences
| Gene name | Primer (5′−3′) | Primer (5′−3′) |
|---|---|---|
| UCP1 | AAGCTGTGCGATGTCCATGT | AAGCCACAAACCCTTTGAAAA |
| Tbp | CCCTATCACTCCTGCCACACCAGC | GTGCAATGGTCTTTAGGTCAAGTTTAC |
| UCP1 | CGTACCAAGCTGTGCGATGT | ACCCGAGTCGCAGAAAAGAA |
| 36b4 | TTTGGGCATCACCACGAAAA | GGACACCCTCCAGAAAGCGA |
| TRPM8 | ACAGACGTGTCCTACAGTGAC | GCTCTGGGCATAACCACACTT |
| Trpv1 | CCGGCTTTTTGGGAAGGGT | GAGACAGGTAGGTCCATCCAC |
| Trpv2 | TGCTGAGGTGAACAAAGGAAAG | TCAAACCGATTTGGGTCCTGT |
| Trpv3 | ACGGTCACCAAGACCTCTC | GACTGTTGGGATTGGATGGGG |
| Trpv4 | ATGGCAGATCCTGGTGATGG | GGAACTTCATACGCAGGTTTGG |
Primers used to do RT-PCR from brown fat.
4
Total RNA Extraction and cDNA Microarray
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA preparation, total RNA was extracted from cells by using TRIzol (TRI) Reagent (Sigma, St. Louis, MO, USA) and the Qiagen RNAeasy (Qiagen, Valencia, CA, USA) column. Labeled probes were applied to a cDNA microarray containing 10,000 gene clone original cDNA fragments as previously described [22 (link)].
5
RNA-seq protocol for canine transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated following manufacturer’s instructions (Invitrogen, Carlsbad, CA) and purified using RNAeasy (Qiagen, Valencia, CA). All samples were processed for RNA-seq and run in one batch at the Biomedical Genomics Core at Nationwide Children’s Hospital, Columbus, Ohio. The quality of total RNA was evaluated using NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE) and Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA). RNA quality was considered acceptable if the RNA integrity number was seven or greater. Ribosomal-RNA was removed from total RNA with Ribo-Zero rRNA removal kit (Illumina), and mRNA libraries constructed (ScriptSeq v2 RNA-Seq library preparation kit, Epicentre Biotech, Madison, WI). Following purification, di-tagged cDNA was amplified by limit-cycle PCR and purified using AMPure XP System (Beckman Coulter) [34 (link),35 (link)]. Paired-end 150 bp sequence reads were generated using Illumina HiSeq 4000 platform, to obtain an average of 50 million reads/sample. Raw reads were cleaned for PCR artifacts and adapter trimmed, then aligned to the canine genome (CanFam 3.1 reference genome) using COBWeb to obtain expression levels for annotated genes and isoforms (Strand NGS, v3.1, Build 235027, Agilent Technologies, Santa Clara, CA) [36 (link)].
6
Cloning Immunoglobulin Heavy-Chains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the immunization procedure, blood samples were collected (100 ml), peripheral blood lymphocytes (PBLs) were enriched by gradient centrifugation from blood and total RNA was isolated from the PBLs to prepare cDNA (RNAeasy, Qiagen, San Diego, CA, United States). The open reading frames encoding all immunoglobulin heavy-chains were amplified by RT-PCR with primers. Nb open reading frames were amplified through a nested PCR using primers to generate flanking sequences amenable to homologous recombination into pSEX81 (PR3005, Progen Biotechnik GmbH, Heidelberg, Baden- Wuerttemberg, Germany). PCR products (10 µg) were mixed with NcoI/BamHI linearized pSEX81 vector (Progen, 10 µg) and ligated by with T4 DNA ligase and electro-transformed into competent E. coli TG1 cells. Transformants were grown in 2TY medium containing 2% glucose and 100 μg/ml ampicillin at 37°C overnight (Sabir et al., 2014 (link)).
7
DTMUV Viral Load Detection in Ducks
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the samples (serum and liver) of ducks with RNAeasy (Qiagen, Germany), and used immediately for cDNA synthesis. cDNA synthesis was performed with SuperScript II reverse transcriptase (RT) (Invitrogen, USA). Then the viral load in the tissues of ducklings was detected using qRT-PCR assay. The primers were designed referring to the sequences of E gene of DTMUV AH-F10. The forward and reverse primers were 5′- ATGTTCAGCTGTCTGGGGATGC-3′ and 5’-GGCATTGACATTTACTGCCAG-3′, respectively.
8
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted (RNAeasy; Qiagen) and converted to cDNA using an iScript cDNA synthesis kit (BIORAD). Quantitative real-time PCR was carried out with SYBR Green Master Mix (Thermo Fisher Scientific), as described previously (41 (link)). Gene expression was normalized to GAPDH and analyzed by the comparative cycle threshold method. Primer sequences are listed in Supplementary Table 1 .
9
Standardized RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was performed following standardized, previously published techniques using RNAEasy (Qiagen, Valencia, CA, USA) protocols13 (link). Details of qRT-PCR methods have been previously published13 (link). At the end of the amplification period, melting curve analysis was performed to confirm the specificity of the amplicon. RNA samples were normalized to cyclophilin A (CPHI), also known as kinase C peptidyl prolyl isomerase A (PPIA), as an internal standard. PPIA expression is stable between normal gravity and μG conditions. Relative quantification of gene expression was calculated by the 2 − ΔΔCt equation. All data derived using qRT-PCR were from independent donor biologic samples.
All data were checked for normality, and standard descriptive statistics computed. Overall treatment and sμG effects were evaluated using analysis of variance (2-way ANOVA) for all continuous variables. Fisher’s exact test was used to determine whether differences between groups were significant. Differences were considered significant at p < 0.05. Data are reported as mean ± SD, unless otherwise noted.
All data were checked for normality, and standard descriptive statistics computed. Overall treatment and sμG effects were evaluated using analysis of variance (2-way ANOVA) for all continuous variables. Fisher’s exact test was used to determine whether differences between groups were significant. Differences were considered significant at p < 0.05. Data are reported as mean ± SD, unless otherwise noted.
10
Total RNA Extraction from Intestinal Mucosae
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!