To extract the total RNA, BV2 cells were seeded in a 6-well plate at a density of 1 × 106 cells/well. The AP extract (0.05, 0.1, and 0.15 mg/mL) or curcumin (20 μM; positive control) was pre-treated for 1 h and co-treated with LPS (1 μg/mL) for 6 h. Then, the supernatant was removed, and the cells were lysed using the Easy-Blue RNA extraction kit (iNTRON Biotechnology, Sungnam, Republic of Korea). RNA purity was confirmed using a Gene Quant Pro RNA Calculator (Biochrom, Inc., Cambridge, UK). RNA was reverse-transcribed to cDNA using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). SYBR quantitative RT-PCR was performed using the ABI StepOne Plus detection system (Applied Biosystems, Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer’s instructions. The PCR cycling conditions were as follows: 95 °C for 3 min; and 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 20 s. For each sample, a triplicate test and a control reaction without reverse transcriptase were analyzed to evaluate the expression of the gene of interest and control variations in the reactions (Table 1 ).
Abi stepone plus detection system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI StepOne Plus detection system is a real-time PCR instrument designed for a variety of nucleic acid analysis applications. It features a compact design, a high-resolution color touchscreen, and intuitive software to enable efficient data collection and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (4 mentions)
Steponeplus software, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Microrna reverse transcription system, by GenePharma (3 mentions)
Sybr green dye, by Bio-Rad (3 mentions)
Revertra ace qpcr rt kit, by Toyobo (2 mentions)
Rnaprotect bacteria reagent, by Qiagen (2 mentions)
Primescript rt reagent kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Easy blue rna extraction kit, by iNtRON Biotechnology (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sybr pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis system kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (1 mentions)
37 protocols using abi stepone plus detection system
1
RNA Extraction and qRT-PCR Analysis
2
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total tissue or cellular RNA was isolated using TRIzol reagents, according to the manufacturer’s instructions (Invitrogene). Residual genomic DNA was removed by on-column digestion with RNase-free DNase I. First-strand cDNAs were synthesized using oligo (dT)12–18 primers and SuperScript III Reverse Transcriptase (Invitrogen). Real-time PCR was performed using SYBR Green and the ABI Step-One Plus Detection System (Applied Biosystems). Primers were designed and compared with the current mouse genome reference sequence using BLAST to ensure that no cross-reactivity with other genes would occur. Results were normalized against the β -actin transcript as an internal control, and were then used to calculate expression levels according to the ΔΔ cycle threshold method. All data were expressed in terms of fold change relative to the unstimulated sample, which was set as 1, unless otherwise specified. The primers were validated for their amplification efficiency and specificity prior to being used in the study.
3
Quantifying mRNA Expression by RT-qPCR
4
Quantifying Gene Expression in Cardiac Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the heart, CFs, and macrophages by Trizol reagent (Invitrogen, Carlsbad, CA, USA) per the manufacturer's protocols. The cDNA was synthesized from 1 μg of RNA with Moloney Murine Leukemia Virus reverse transcriptase and oligo (dT) 18 primer. According to the manufacturer's instructions, a quantitative RT-PCR (Q-PCR) was performed using the SYBR PCR master mix in the ABI Step One-Plus Detection system (Applied Biosystems, USA). PCR conditions were 95°C for 10 min and 40 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 1 min. 18s (for mRNA) was served as a control, and the target gene expression was calculated by the 2-ΔΔCT method comparative method. The primers were listed in Table S1 .
5
Western Blot and qPCR Analysis of Hedgehog Pathway Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot analysis and real-time qPCR were conducted as previously described
[16] (link). Specifically, an antibody recognizing Gli1 was purchased from Cell Signalling Technology (cat: L42B10; Beverly, USA), an antibody recognizing Gli2 was purchased from Santa Cruz (cat: sc-271786), an antibody recognizing BGN was purchased from Abcam (cat: ab58562; Cambridge, UK), and an antibody recognizing GAPDH was purchased from Millipore (cat: MAB374; Billerica, USA). Total protein was extracted from the cells or tissues using lysis buffer (0.5% Lubrol-PX, 50 mM KCl, 2 mM CaCl
2, 20% glycerol, 50 mM Tris-HCl, pH 7.4, containing 1% protease inhibitor cocktail), and the relative levels of the indicated proteins were analysed by western blot analysis using the indicated antibodies. For qPCR, total RNA was extracted from the cells or tissues using Trizol reagent, and 1 μg of total RNA was used for reverse transcription. An ABI StepOne Plus detection system (Applied Biosystems, Foster City, USA) was used to perform real-time qPCR. The sequences of the primers used to detect the target gene are shown in
Table 3 .
[16] (link). Specifically, an antibody recognizing Gli1 was purchased from Cell Signalling Technology (cat: L42B10; Beverly, USA), an antibody recognizing Gli2 was purchased from Santa Cruz (cat: sc-271786), an antibody recognizing BGN was purchased from Abcam (cat: ab58562; Cambridge, UK), and an antibody recognizing GAPDH was purchased from Millipore (cat: MAB374; Billerica, USA). Total protein was extracted from the cells or tissues using lysis buffer (0.5% Lubrol-PX, 50 mM KCl, 2 mM CaCl
2, 20% glycerol, 50 mM Tris-HCl, pH 7.4, containing 1% protease inhibitor cocktail), and the relative levels of the indicated proteins were analysed by western blot analysis using the indicated antibodies. For qPCR, total RNA was extracted from the cells or tissues using Trizol reagent, and 1 μg of total RNA was used for reverse transcription. An ABI StepOne Plus detection system (Applied Biosystems, Foster City, USA) was used to perform real-time qPCR. The sequences of the primers used to detect the target gene are shown in
| Primer name | Sequence (5′→3′) | |
BGN | BGN-rt-f | GAGACCCTGAATGAACTCCACC |
BGN-rt-r | CTCCCGTTCTCGATCATCCTG | |
Gli2 | Gli2-rt-f | CCACCACCTCACCCAGTCCA |
Gli2-rt-r | CAAAGCCTGCTGTAGCCACCC | |
Ptch1 | Ptch1-rt-f | GGGTGGCACAGTCAAGAACA |
Ptch1-rt-r | GGTCGTGGTGGTGAAGGAA |
6
ChIP-qRT-PCR: Transcription Factor Binding Analysis
7
qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR analysis was performed as described earlier38 (link). Briefly, total RNA was extracted from LNCaP cells treated with DMSO or BBR for various lengths of time and the integrity of 18 S and 28 S ribosomal RNA assessed by gel electrophoresis to confirm RNA quality. cDNA synthesis was performed using Superscript III First-Strand Synthesis System kit (Invitrogen, Carlsbad, CA) and amplified using SYBR Green PCR Master Mix (Applied Biosystems) in ABI StepOnePlus detection system (Applied Biosystems). The PCR cycling condition was set as: 50 °C for 2 min followed by an initial denaturation step at 95 °C for 10 min, 40 cycles at 90 °C for 10 s, 60 °C for 30 s finally subjecting to melting temperature to check amplification curve. The relative changes in gene expression were estimated using the 2−ΔΔCt method using 18 S rRNA as a housekeeping gene. The lists of primers used are included in Supplementary Table S1 .
8
Profiling Macrophage and Exosomal RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of macrophages as well as exosomal RNA was extracted using RNeasy mini kit (Qiagen, CA, USA) according to manufacturer's instructions. Residual genomic DNA of macrophages and exosomes was removed by incubating with Rnase-free DNase set (Qiagen). RNA was analyzed and quantified using nanodrop 2000c (Thermo Scientific, USA). As quality controls of RNA samples purity from contaminating DNA and chaotropic salts was obtained by absorbance Ratio A260/A280 and A260/A230, respectively. RNA (1 µg) isolated from resting and polarized macrophages cells and their respective exosomes was reverse transcribed with Superscript III First-Strand synthesis system for RT-PCR (Invitrogen, CA, USA) according to manufacturer's protocol. To quantify mRNA levels, quantitative reverse transcription PCR was performed using an ABI StepOne Plus Detection System (Applied Biosystems, MA, USA). TaqMan PCR Universal Master Mix and Expression Assays were from Applied Biosystems. Assay IDs: iNOS Mm00440502_m1, CD206 Mm00485148_m1 and CD63 Mm01966817_g1. CD63 was used as exosomal marker and CD11b as macrophage cells marker.
9
Quantitative RT-PCR Analysis of P. aeruginosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from P. aeruginosa PAO1 was isolated with an RNeasy Mini Kit (Qiagen) and RNAprotect Bacteria Reagent (Qiagen), according the manufacturer’s instructions. DNase I (Turbo DNA-free, Applied Biosystems) was used to remove DNA contamination. Reverse transcription PCR (RT-PCR) was performed with 1 μg of RNA in a total 20-μl reaction volume, using the SuperScript III First-Strand Synthesis System for RT-PCR (Applied Biosystems), and PCR amplification of the cDNA was performed with High-Fidelity PCR enzyme mix (Fermentas). Primers used in this study are listed in S1 Table . The first-strand cDNA synthesis step was conducted at 55ºC for 1 h, and the cycling conditions for PCR were performed as follows: 3-min denaturation period at 94ºC; 20 cycles for 1 min at 94ºC, 45 s at 51ºC, and 1 min per kb of DNA template at 72ºC; and final 7-min extension at 72ºC.
Real-Time PCR measurements were carried out using TaqMan primers and probes (S1 Table ), and detection was performed using and ABI Step One Plus detection system from Applied Biosystems as described previously [12 (link)]. The gapA sequence was used as an internal standard since their expression is constitutive during P. aeruginosa growth.
Real-Time PCR measurements were carried out using TaqMan primers and probes (
10
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an Easy-Blue™ Total RNA extraction kit according to the manufacturer's instructions and reverse transcription of RNA to cDNA was performed using an ABI cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA) (conditions: 37°C for 1 h, followed by 95°C for 5 min). TaqMan quantitative RT-PCR with an ABI StepOne Plus detection system was performed according to the manufacturer's instructions (Applied Biosystems; Thermo Fisher Scientific, Inc.). For each sample, triplicate test reactions and a control reaction without reverse transcriptase were analyzed for expression of the gene of interest and to control for variations in the reactions. All qPCR data were normalized to levels against the housekeeping gene hypoxanthine guanine phosphoribosyltransferase (HPRT). Forward, reverse, and probe oligonucleotide primers for multiplex real-time TaqMan PCR were purchased from ABI (Applied Biosystems; Thermo Fisher Scientific, Inc.). Cycling conditions were 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. The data were analyzed using StepOne™ software (version 2.3; Applied Biosystems; Thermo Fisher Scientific, Inc.). The 2−ΔΔCq method was used to determine the relative mRNA expression level (20 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!