Puromycin
Puromycin is a laboratory reagent commonly used in molecular biology and cell culture experiments. It functions as a selective antibiotic that inhibits protein synthesis in eukaryotic cells. Puromycin is often utilized as a selection marker in genetic engineering experiments to identify and isolate cells that have successfully integrated a target gene of interest.
Lab products found in correlation
18 protocols using puromycin
Lentiviral Transduction and GLUT3 Overexpression in PC12 Cells
Lentiviral Overexpression and Knockdown of miR-218 and RICTOR
Lentiviral vectors encoding short hairpin RNA (shRNA) targeting human RICTOR were constructed by GenPharma (Shanghai, China). The specific sequences of shRNA used for targeting human RICTOR were: 5′-GCCGTATACTCCTTCGCAAAG-3′ (#1) and 5′- GCAACCAACTGAGTGCAATAT -3′ (#2). The scrambled lentiviral vector was used as a negative control. The cells were transfected with the lentiviral vectors as above. Afterward, cells were analyzed using real-time quantitive PCR (qPCR) and Western blotting assay for RICTOR expression.
MTHFD1L Knockdown in TSCC Cells
We used established stable cell lines from the CAL-27 and SCC-15 cell lines by selection with 3 μg.mL−1 puromycin for 3 weeks. We purchased adenoviruses from GenePharma Co., Ltd.
Lentiviral Transduction of miR-1
Lentiviral BRD4 Knockdown in Prostate Cancer
Overexpression and Knockdown of TFAP2B in Thyroid Cancer Cells
We use KTC-1, Bcpap and TPC-1 cells lines to establish stable cell lines by selection with 1 lg.mL−1 puromycin for 4 weeks, and adenoviruses were purchased from GenePharma Co., Ltd.
Knockdown of GAB2 in PC-3 Prostate Cancer Cells
Lentiviral Modulation of miR-210-5p and PIK3R5 in Osteosarcoma
Lentiviral Vectors for Colon Cancer Cell Fusion
Visualizing Nuclear Fusion in Colon Cancer
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!