In fusion hd

The S. thermophilus QueG gene was PCR amplified using primers StpNHis1622F (CAAGGCGCCCAGATCTCAATGAATATCAAACTGGAAATCCAGAAAATG) and StpNHis1622R (GGCCGGTACCGGATCCTTAAATCTGCCATTTCGCACAAACG) using Phusion polymerase (NEB). The PCR product was cloned into the BglII and BamHI sites of pN-His-TEV1622 plasmid (15 (link)) using Infusion HD (Clontech) and transformed into E. coli NEB5α. Once the sequence of the insert was confirmed the purified plasmid was transformed into B. megaterium DSM319, using the modified minimal medium protoplast transformation protocol (16 (link)).

Loop-swapped mutants of DRD1 were constructed as follows. pEU-E01-DRD1 plasmid was linearized by inverse PCR and arbitrary loop/terminus region was removed. The homologous loop/terminus region of ADRB2 or HRH2 was amplified by PCR. The PCR fragments were connected by using In-Fusion HD (Clontech). Wild-type and loop-swapped mutants were synthesized with bilayer method in the presence of biotinylated liposome. Antigen-antibody reaction was assayed by BiLIA as described above.

pCold-HisHRV-3C-Loqs-PD was a kind gift from Dr. Fukunaga^{13 (link)}. The pASHaloW Gateway destination vector was generated by inserting a DNA fragment containing the Halo tag and TEV protease recognition sequence from pFN18A (Promega) into pASW^{28 (link)}, at a 3′ downstream site of the SBP sequence by In-FusionHD (Clontech). To construct pASHaloW-Dcr-2, a DNA fragment containing the Dcr-2 gene was amplified from pASW-Dcr-2^{29 (link)} and cloned into pENTR/D-TOPO (Invitrogen), followed by recombination with pASHaloW with Gateway LR Clonase II (Invitrogen). pAHisHaloW-Dcr-2 was constructed from pASHaloW-Dcr-2 by substituting the SBP sequence with 6×His. The G31R (helicase) and D1217A/D1476A (RNase III) mutations were introduced by QuikChange site-directed mutagenesis (Stratagene) (Supplementary Table 1).

The pNL1.1 plasmids express the nanoluciferase protein (Nluc). Promoter and 5′-UTR sequences of candidate genes were taken from NCBI and Ensembl databases (Table 2). Infusion primers were designed to amplify promoter (approximately 2000 bps upstream of the transcription start site) and 5′-UTR-encoding sequences using the primer design tool on the Clontech website. Internal primers were designed to merge the Gapdh promoter region and the 5′-UTR of the candidate.
The promoter and 5′-UTR sequences were amplified using the infusion primers and the overlapping internal primers on gDNA from mouse liver or cDNA from cultured mouse astrocytes (Table 2) according to the manufacturer’s protocol (ClonAmp, In-Fusion HD, Clontech). For the chimeric constructs comprising the murine Gapdh core promoter and 5′-UTR of the candidate mRNA a triple infusion reaction was performed with the pNL1.1 vector, the amplified promoter product and the amplified 5′-UTR product (Table 2). All promoter and 5′-UTR sequences were inserted into the pNL1.1 vector (Promega) using an infusion reaction according to the manufacturer’s protocol (In-Fusion^® HD Cloning Kit, Clontech). The resulting plasmids are listed in Table 2. PCR-amplified sequences of all constructs were confirmed by sequence analysis.

Bacterial pOPIN-B expression vectors (Berrow et al., 2007 (link)) for SARS-CoV-2 PLpro amino acids (aa) 1563-1878 of polyprotein 1 ab, GenBank: QHD43415, with aa E1564 designated as residue 1, were reported previously (Klemm et al., 2020 (link)). SARS-CoV PLpro^WT (aa 1541-1855 of polyprotein 1 ab, RefSeq: NP_828849.7) and MERS-CoV PLpro^WT (aa 1482-1803 of polyprotein 1 ab, RefSeq: YP_009047202) were codon optimised for bacterial expression, synthesized (Integrated DNA Technologies) and cloned into pOPIN-B digested with KpnI and HindIII using In-Fusion® HD cloning (Takara Clontech). The SARS-CoV-2 PLpro BL2 mutant (SARS-CoV-2 PLpro^BL) was generated by NEB Q5® Site-Directed Mutagenesis of the SARS-CoV-2 PLpro^WT plasmid (fwd 5′-GAG​TAT​ACG​GGC​ATC​GAG​ACT​GCA​GTC​GGT​CAC​TAC​AAA C-3′, rev 5′-CGA​TGC​GCA​GGT​GAA​CGT​TC-3′).
For crystallography, we matched a construct used previously (Osipiuk et al., 2021 (link)), which has a 1-aa shorter SARS-CoV-2 PLpro sequence (aa 1564-1878) preceded by a Ser-Asn-Ala sequence and includes a catalytic Cys111 mutation to Ser (SARS-CoV-2 PLpro^C111S). The coding sequence was cloned into pOPIN-S which features a His-SUMO-tag. SUMO protease (SENP1) was produced according to (Pruneda et al., 2016 (link)).