Hvsmcs

Manufactured by American Type Culture Collection

Sourced in United States

The HVSMCs are a collection of human vascular smooth muscle cells (HVSMC) provided by American Type Culture Collection (ATCC). HVSMCs are primary cells isolated from the vascular tissue of human donors and are intended for use in in vitro cell culture research.

Automatically generated - may contain errors

Lab products found in correlation

14 protocols using hvsmcs

Cell Culture of Primary Aortic Smooth Muscle and HEK Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

hVSMCs, primary aortic smooth muscle cells (ATCC‐PCS‐100‐012), and human embryonic kidney (HEK) 293T cells (ATCC‐CRL‐11268) were purchased from American Type Culture Collection. hVSMCs were cultured in vascular basal media (ATCC PCS‐100‐030) supplemented with the vascular smooth muscle growth kit (ATCC PCS‐100‐042), 100 U/mL penicillin, and 100 μg/mL streptomycin. hVSMCs were used between passages 2 and 5. HEK293T cells were cultured in high‐glucose Dulbecco's modified Eagle medium containing 10 mg/mL sodium pyruvate, 2 mmol/L l‐glutamine, 10% (vol/vol) FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. The HTLA cell line, a HEK293 cell line stably expressing a tTA‐dependent luciferase reporter and a β‐arrestin2‐TEV fusion gene,21 was generously provided by the laboratory of Dr Bryan Roth and maintained in high glucose Dulbecco's modified Eagle medium supplemented with 10% (vol/vol) heat‐inactivated FBS, 1× nonessential amino acids, 100 U/mL penicillin, 100 μg/mL streptomycin, 50 μg/mL hygromycin B, and 2 μg/mL puromycin. All cells were cultured in a humidified environment at 37°C, 5% CO₂.

Albee L.J., Eby J.M., Tripathi A., LaPorte H.M., Gao X., Volkman B.F., Gaponenko V, & Majetschak M. (2017). α1‐Adrenergic Receptors Function Within Hetero‐Oligomeric Complexes With Atypical Chemokine Receptor 3 and Chemokine (C‐X‐C motif) Receptor 4 in Vascular Smooth Muscle Cells. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 6(8), e006575.

+ Open protocol

+ Expand

Modulating miR-155 in Immune and Vascular Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human cell line THP-1 and human vascular smooth muscle cells (HVSMCs) were purchased from ATCC (American Type Culture Collection, Nr. TIB-202, Wesel, Germany). The human cell line THP-1 was cultured in RPMI-1640 media (Thermo Scientific, Waltham, U.S.A.) supplemented with 10% fetal bovine serum (PAA) and 100 μM P/S (Sigma-Aldrich). Cells were maintained at densities between 0.5 and 1.0 × 10⁶cells/ml in culture. HVSMCs were grown in medium DMEM/F12 (Gibco. Grand Island, NY) supplemented with 20% fetal bovine serum (PAA) and 100 μM P/S (Sigma-Aldrich). Cells were incubated at 37˚C and 5% CO₂–95% air.
The miR-155 mimic (Thermo Fisher, Waltham, MA, U.S.A.) and miR-155 inhibitor (Exiqon Inc, Woburn, MA, U.S.A.) were transfected into THP-1 cells by using X-treme GENE siRNA transfection reagent (Mirus Bio LLC, Madison, WI, U.S.A.). Cells were transfected with nonsense sequence as controls (mimic NC and inhibitor NC). Inhibitor sequence were as follows: nonsense control (inhibitor NC) GTGTAACACGTCTATACGCCCA (Exiqon; 199020-00) and miR-155 inhibitor sequences were GTGTAACACGTCTATACGCCCA (Exiqon; 428232-00). miR-155 mimic sequences were UUAAUGCUAAUUGUGAUAGGGGU/AM17100 and miR control sequences were AM17111. THP-1 cells were transfected for approximately 48 h before transfection reagents were removed.

Zhang Z., Liang K., Zou G., Chen X., Shi S., Wang G., Zhang K., Li K, & Zhai S. (2018). Inhibition of miR-155 attenuates abdominal aortic aneurysm in mice by regulating macrophage-mediated inflammation. Bioscience Reports, 38(3), BSR20171432.

+ Open protocol

+ Expand

Culturing human vascular smooth muscle cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human vascular smooth muscle cells (hVSMCs) were purchased from BeNA Culture Collection (BNCC332960). hVSMCs were cultured in F-12 K (ATCC, Catalog No. 30-2004) complete growth medium. To make the complete growth medium, the following components were added to the F-12 K base medium: 0.05 mg/ml ascorbic acid, 0.01 mg/ml insulin, 0.01 mg/ml transferrin, 10 ng/ml sodium selenite, 0.03 mg/ml Endothelial Cell Growth Supplement (ECGS), fetal bovine serum (Unovl Biotechnology, 107-FBS-500) to a final concentration of 10%, HEPES to a final concentration of 10 mM, and TES to a final concentration of 10 mM. Cells were cultured at 37 °C and 5% CO₂.

Li H., Xu J., Zhang Y., Hong L., He Z., Zeng Z, & Zhang L. (2022). Astragaloside IV alleviates senescence of vascular smooth muscle cells through activating Parkin-mediated mitophagy. Human Cell, 35(6), 1684-1696.

+ Open protocol

+ Expand

Platelet-rich plasma effect on endothelial and smooth muscle cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Batches of outdated human platelet rich plasma (PRP) were purchased from Taiwan blood service foundation (Hsinchu blood centre, Taiwan), in which any experimental works involved the use of human PRP were approved by the research ethics committee for human subject protection, National Chiao Tung University. Human umbilical endothelial cells (HUVECs, ATCC CRL-1730) were cultured in endothelial cell medium (ScienCell, Cat# 1001) and maintained at 37 °C under a 5% CO₂ atmosphere. Human vascular smooth muscle cells (hVSMCs, ATCC CRL-1999) were cultured in M199 (Sigma Aldrich, Cat# M4530) with 10% foetal bovine serum (FBS) and maintained at 37 °C under a 5% CO₂ atmosphere. The conditioned media used for both mammalian cell lines were changed every two days and passaged when the cell confluency reached ∼80%.

Cheng B., Xing Y.M., Shih N.C., Weng J.P, & Lin H.C. (2018). The formulation and characterization of 3D printed grafts as vascular access for potential use in hemodialysis. RSC Advances, 8(28), 15471-15479.

+ Open protocol

+ Expand

Culturing Primary Aortic Smooth Muscle Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

hVSMCs (primary aortic smooth muscle cells, ATCC PCS-100-012) were purchased from American Type Culture Collection. As described previously [24 (link), 25 (link)], hVSMCs were cultured in vascular basal media (ATCC PCS-100-030) supplemented with the vascular smooth muscle growth kit (ATCC PCS-100-042), containing 100 U/mL penicillin, and 100 μg/mL streptomycin. hVSMCs were used between passages 2–5.

Albee L.J., Gao X, & Majetschak M. (2021). Plasticity of seven-transmembrane-helix receptor heteromers in human vascular smooth muscle cells. PLoS ONE, 16(6), e0253821.

+ Open protocol

+ Expand

Cell Culture Conditions for VSMCs, A7r5, and HEK293T

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

hVSMCs (primary aortic smooth muscle cells, ATCC PCS-100-012), A7r5 cells (ATCC-CRL-1444) and HEK293T cells (ATCC-CRL-11268) were purchased from American Type Culture Collection. hVSMCs were cultured in vascular basal media (ATCC PCS-100-030) supplemented with the vascular smooth muscle growth kit (ATCC PCS-100-042), containing 100 U ml⁻¹ penicillin and 100 µg ml⁻¹ streptomycin. hVSMCs were used between passages 2–5. HEK293T and A7r5 cells were cultured in high-glucose Dulbecco's Modified Eagle's Medium containing 10 mg ml⁻¹ sodium pyruvate, 2 mM l-glutamine, 10% (vol/vol) FBS, 1× non-essential amino acids, 100 U ml⁻¹ penicillin and 100 µg ml⁻¹ streptomycin. The HTLA cell line, a HEK293 cell line stably expressing a tTA-dependent luciferase reporter and a β-arrestin 2–TEV fusion gene [27 (link)] were generously provided by the laboratory of Dr Bryan Roth and maintained in high-glucose Dulbecco's Modified Eagle's Medium supplemented with 10% (vol/vol) FBS, 1× non-essential amino acids, 100 U ml⁻¹ penicillin, 100 µg ml⁻¹ streptomycin, 50 µg ml⁻¹ hygromycin B and 2 µg ml⁻¹ puromycin. All cells were cultured in a humidified environment at 37°C, 5% CO₂.

Albee L.J., LaPorte H.M., Gao X., Eby J.M., Cheng Y.H., Nevins A.M., Volkman B.F., Gaponenko V, & Majetschak M. (2018). Identification and functional characterization of arginine vasopressin receptor 1A : atypical chemokine receptor 3 heteromers in vascular smooth muscle. Open Biology, 8(1), 170207.

+ Open protocol

+ Expand

Culturing Human Aortic Vascular Smooth Muscle Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human aortic VSMCs (hVSMCs) purchased from the ATCC (Manassas, VA, USA) were grown in culture dishes using smooth muscle cell growth medium (Gibco BRL, Grand Island, NY, USA), smooth muscle growth supplement (Gibco BRL), 10% fetal bovine serum, antibiotic-antimycotic solution (Gibco BRL). Cells were incubated at 37°C in a humidified atmosphere containing 5% CO₂/95% air. hVSMCs between passages 4 and 8 were used for this experiment.

Jang E.J., Kim H., Baek S.E., Jeon E.Y., Kim J.W., Kim J.Y, & Kim C.D. (2022). HMGB1 increases RAGE expression in vascular smooth muscle cells via ERK and p-38 MAPK-dependent pathways. The Korean Journal of Physiology & Pharmacology : Official Journal of the Korean Physiological Society and the Korean Society of Pharmacology, 26(5), 389-396.

+ Open protocol

+ Expand

Evaluating Vascular Cell Viability with Curcumin and Nitric Oxide

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human aortic endothelial cells (HAECs), human vascular smooth muscle cells (HVSMCs), and human brain vascular adventitial fibroblasts (HBVAFs) were bought from ATCC (Virginia, America). HAECs were cultured in endothelial cell medium, while HVSMCs and HBVAFs were cultured in DMEM and MEM medium, respectively, supplemented with 10% FBS and 1% penicillin‐streptomycin. All cell culture media and reagents were purchased from Gibco (California, America).
The viability of HAECs was assessed using a cell counting kit‐8 (CCK‐8) (KeyGEN Biotechnology, Jiangsu, China). After 24 h of attachment, HAECs were divided into five groups: PBS, H₂O₂ (100 µM), H₂O₂ + Cur (25 µM), H₂O₂ + NO‐Gel (NO donor, 75 µM), and H₂O₂ + Cur‐NO‐Gel (Cur concentration, 25 µM), and incubated for 24 h. β‐galactosidase was added to all culture media containing NO donor at a dose of 0.2 U mL⁻¹. Then, the cells were incubated with CCK‐8 assay buffer and detected using a microplate reader (Bio‐RAD iMark™, California, America). The viability of HVSMCs and HBVAFs was evaluated using a similar approach.

Fu C., Li Q., Li M., Zhang J., Zhou F., Li Z., He D., Hu X., Ning X., Guo W., Li W., Ma J., Chen G., Xiao Y., Ou C, & Guo W. (2024). An Integrated Arterial Remodeling Hydrogel for Preventing Restenosis After Angioplasty. Advanced Science, 11(15), 2307063.

+ Open protocol

+ Expand

Culture and Maintenance of HEK293T, hVSMCs, and HTLA Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human embryonic kidney 293 T (HEK293T) cells (CRL-3216) and human primary aortic vascular smooth muscle cells (hVSMCs, PCS-100–012) were purchased from American Type Culture Collection. HEK293T cells were cultured in high glucose Dulbecco’s modified Eagle medium supplemented with 10% FBS, 100 U·mL⁻¹ penicillin, and 100 μg·mL⁻¹ streptomycin. hVSMCs were cultured in vascular basal media (ATCC PCS-100–030) supplemented with the vascular smooth muscle growth kit (ATCC PCS-100–042), 100 U·mL⁻¹ penicillin, and 100 μg·mL⁻¹ streptomycin. The HTLA cell line, a HEK293 cell line stably expressing a tTA-dependent luciferase reporter and a β-arrestin 2-TEV fusion gene was generously provided by the laboratory of Bryan Roth and maintained in high glucose Dulbecco’s modified Eagle medium supplemented with 10% FBS, 100 U·mL⁻¹ penicillin, 100 μg·mL⁻¹ streptomycin, 100 μg·mL⁻¹ hygromycin B, and 2 μg·mL⁻¹ puromycin. All cells were cultured in a humidified environment at 37 °C, 5% CO₂.

Gao X., DeSantis A.J., Enten G.A., Weche M., Marcet J.E, & Majetschak M. (2022). Heteromerization between α1B-adrenoceptor and chemokine (C-C motif) receptor 2 biases α1B-adrenoceptor signaling: Implications for vascular function. FEBS letters, 596(20), 2706-2716.

+ Open protocol

+ Expand

Human Vascular Smooth Muscle Cells Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

hVSMCs were purchased from American Type Culture Collection. Cells were maintained in Dulbecco's modified Eagle's medium (HyClone; Cytiva) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 mg/ml streptomycin at 37˚C with 5% CO₂.

Wang D, & Yan C. (2021). MicroRNA-208a-3p participates in coronary heart disease by regulating the growth of hVSMCs by targeting BTG1. Experimental and Therapeutic Medicine, 23(1), 71.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!