The Dual-Luciferase Reporter Assay System (Promega) was used to determine luciferase activities according to the manufacturer’s instructions. Cells in 96-well plates were transfected with Shh-firefly luciferase vector and Renilla luciferase vector under control of the ubiquitin promoter per well using Lipofactamine 2000. After 24 h, cells were treated as indicated and lysed with Passive Lysis Buffer (Promega). Measurements were performed with a Berthold luminometer (Berthold Technologies, Bad Wildbad, Germany), and firefly luciferase values were normalized to Renilla luciferase values.
Berthold luminometer
Manufactured by Berthold Technologies
Sourced in Germany
The Berthold luminometer is a versatile instrument used for the detection and quantification of luminescent signals. It operates on the principle of bioluminescence and chemiluminescence, providing accurate and sensitive measurements of light emission from various samples.
Automatically generated - may contain errors
Lab products found in correlation
Passive lysis buffer (plb), by Promega (2 mentions)
Dual luciferase reporter assay system, by Promega (2 mentions)
Prl tk plasmid, by Promega (1 mentions)
Dual luciferase reporter kit, by Promega (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Secrete pair dual luminescence assay kit, by GeneCopoeia (1 mentions)
Superfect transfection reagent, by Qiagen (1 mentions)
Puno1 control vector, by InvivoGen (1 mentions)
Dual luciferase protocol, by Promega (1 mentions)
Renilla plasmid, by Promega (1 mentions)
Phusion hot start high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Prl tk, by Promega (1 mentions)
Pmirtarget vector, by OriGene (1 mentions)
Pgem t easy, by Promega (1 mentions)
Luciferase assay system, by Promega (1 mentions)
D luciferin, by GoldBio (1 mentions)
10 protocols using berthold luminometer
1
Dual-Luciferase Reporter Assay for Shh Signaling
2
Optimized Chemiluminescent ELISA for VEGF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Several physicochemical factors that influenced the chemiluminescent ELISA performance were carefully optimized in this work. In order to evaluate the influence of CAT–VEGF conjugate, direct ELISA was performed as follows: The 96-well plates were first coated with 100 μL of anti-VEGF monoclonal antibody (1 μg mL−1) in PBS (pH 7.0) and incubated overnight at 4 °C. After washing thrice with PBST, 300 mL of BSA solution (1.0 mg mL−1) was used to block the excess sites of the wells. After 2 h of incubation at 37 °C, the microplate was washed with the same procedure. Subsequently, 100 mL of different dilution of CAT–VEGF conjugate in PBS was added into the wells for 2 h at 37 °C. After washing thrice with PBST and once with PBS, 100 μL of 300 mM H2O2 in 0.01 M PB (pH 7.0) was injected for 1 min. Finally, 100 μL of TGA-CdTe QDs was injected into the well, and the CL signals of the TGA-CdTe QDs were measured by using Berthold luminometer (Titertek-Berthold, Sirius L, Pforzheim, Germany). The effect of the enzyme reaction time on the substrate was also investigated by the assay procedure described above with constant concentration of CAT–VEGF conjugate in different reaction times of 2–120 s.
3
Transient Co-Transfection of SH-SY5Y Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-SY5Y cells were transiently co-transfected with the indicated pGL2 luciferase reporter plasmids and with the Renilla-encoding pRL-TK plasmid (Promega Inc.). Twenty-four hours after transfection, cells were lysed and luciferase activity quantified using the Dual Luciferase Reporter kit (Promega Inc.) and a Berthold luminometer (Berthold Technologies). For the luciferase experiments, paraquat was added 3 h after transfection.
4
FSP1 Promoter Assay in M1-Polarized MDMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FSP1 promoter assay was done as described in ref. 28 (link). FSP1 promoter construct plasmid containing 1.0–1.3 kb insert, corresponding to the 5′-flanking sequence located ~1.3 kb upstream and up to 200 bp downstream of the transcription initiation site of human FSP1 (NM_002961) HPRM17407-PG04 (GeneCopoeia) inserted upstream of the GLuc reporter gene was used. M1-polarized human MDMs polarized were co-transfected with the FSP1 promoter reporter construct and miR-21 mimic using Lipofectamine LTX (Thermo Fisher Scientific). Media were collected 48 h post transfection and the secreted GLuc and SEAP activities were measured with the Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia) according to the manufacturer’s protocol using the Berthold Luminometer (Berthold Technologies). Normalized promoter activity has been presented as the ratio of GLuc to SEAP activities.
5
Transient Plasmid Transfection Assay
6
Luciferase Assay for 3'UTR Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pre-miR-129-1-expressing plasmid pMir and the pMir Target vector carring the HOXC10 3' untranslated region (UTR) reporter were purchased from Origene. The CACNG2 and ELAVL4/HuD 3'UTR regions were amplified using Phusion Hot Start High-Fidelity DNA Polymerase (Finnzymes) according to the manufacturer's instructions. Human genomic DNA extracted from HeLa cells was used as a template in the PCR reactions. The sequences of the oligonucleotides used in the PCR reactions are provided in Supplemental Table S1. PCR products were purified, cloned into pGEM T Easy (Promega) and sequenced. The HuD plasmid was purchased from Addgene (Plasmid #65760).
For luciferase assays, 1.5 x 10 5 cells/well were seeded in a 24-multiwell plate, and plasmids were transfected the following day using polyethylenimine (PEI, Sigma) according to the manufacturer's instructions. A constant amount of pRL-TK (Promega) was cotransfected with the pMiR, and the construct contained the specific 3'UTR fragment downstream of the firefly luciferase ORF. Twenty-four hours after transfection, cells were lysed in 100 µg/well of 1x passive lysis buffer according to the manufacturer's instructions. The cells were subjected to freeze-thawing to obtain complete lysis. The luciferase assays were carried out using the Dual-Luciferase Reporter Assay System (Promega) and a Berthold luminometer (Berthold, Inc.)
For luciferase assays, 1.5 x 10 5 cells/well were seeded in a 24-multiwell plate, and plasmids were transfected the following day using polyethylenimine (PEI, Sigma) according to the manufacturer's instructions. A constant amount of pRL-TK (Promega) was cotransfected with the pMiR, and the construct contained the specific 3'UTR fragment downstream of the firefly luciferase ORF. Twenty-four hours after transfection, cells were lysed in 100 µg/well of 1x passive lysis buffer according to the manufacturer's instructions. The cells were subjected to freeze-thawing to obtain complete lysis. The luciferase assays were carried out using the Dual-Luciferase Reporter Assay System (Promega) and a Berthold luminometer (Berthold, Inc.)
7
BCL2L10 Promoter Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The BCL2L10 promoter was amplified from genomic DNA from HUVEC cells using the primers: −1674 (forward) 5′CTCTTTCATGTGGTACCAGCAC3′ and +234 (reverse) 5′TTACGGCAGATTCACCGGTC3′. The purified product was amplified in a semi-nested PCR using the same forward primer and the reverse primer +115 5′GGGAGCGCACTCGAGCTGTTG3′. The smaller fragments were generated using the +115 reverse primer and the following forward primers: −703 5′ACCCAGTCTATGGCATTCTGC3′, −678 5′ GCCGCCTGGTACCAGACTAAGAC 3′ and −548 5′ CCACTGCTGGTA CCATTCTGC 3′. The three promoter fragments were cloned into the Xho I y Kpn I sites of the pGL2-Basic plasmid. Site-directed mutagenesis of STAT3 sites was performed using the QuikChange II kit (Stratagene, San Diego, CA, USA) following the manufacturer’s protocol. Cell lysates were prepared from lipofectamine-transfected cells after 24 or 48 h. Luciferase activity was measured with the luciferase assay system (Promega, Madison, WI, USA) in a Berthold luminometer (Berthold Technologies, Bad Wildbad, Germany, Germany) and was normalized with β-galactosidase activity measured in the same sample. Results are shown as the mean (bar) ± SD
8
Quantification of Viral Luciferase Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single-cell suspensions obtained from tissues or infected cells were lysed in 1X Passive Lysis Buffer (Promega) for 5 min at 37°C, and lysates were added to white-bottom 96-well flat-bottom plates (Costar, Corning, NY). Luciferase activity was measured after adding appropriate substrate (Promega Firefly Luciferase Assay substrate for firefly luciferase, or Promega nanoGlo nanoLuciferase substrate for NLuc and Antares, diluted 1:40 in PBS per manufacturer’s instructions) using a Berthold luminometer (Berthold Technologies, Bad Wildbad, Germany). Luciferase activity associated with virions was performed on partially purified viruses that were sedimented through a 15% sucrose cushion in PBS at 25,000 × g for 2 hr at 4°C. Sedimented viral pellets were resuspended in 0.1% BSA/PBS and diluted accordingly for detection within the luminometer linear range. For MLV Gag-Fluc virion luciferase assays, sedimented viral pellets were resuspended in 0.1% BSA/PBS or Passive Lysis Buffer (Promega). ATP-free or ATP-containing (150 μM ATP) substrate solutions were prepared containing 150 μg/ml D-luciferin (Goldbio, St. Louis, MO), 100 mM Tris pH 8, and 5 mM MgCl2. Relative light units (RLU) were determined by taking luciferase readings of lysis buffer or PBS/0.1% BSA.
9
Optimizing Chemiluminescent ELISA Performance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Several physicochemical factors that in uenced the chemiluminescent ELISA performance were carefully optimized in this work. In order to evaluate the in uence of CAT-VEGF conjugate, direct ELISA was performed as follows: The 96-well plates were rst coated with 100 μL of anti-VEGF monoclonal antibody (1 μg mL -1 ) in PBS (pH 7.0) and incubated overnight at 4 °C. After washing thrice with PBST, 300 mL of BSA solution (1.0 mg mL -1 ) was used to block the excess sites of the wells. After 2 h of incubation at 37 °C, the microplate was washed with the same procedure. Subsequently, 100 mL of different dilution of CAT-VEGF conjugate in PBS was added into the wells for 2 h at 37 °C. After washing thrice with PBST and once with PBS, 100 μL of 300 mM H 2 O 2 in 0.01 M PB (pH 7.0) was injected for 1 min. Finally, 100 μL of TGA-CdTe QDs was injected into the well, and the CL signals of the TGA-CdTe QDs were measured by using Berthold luminometer (Titertek-Berthold, Sirius L, Pforzheim, Germany). The effect of the enzyme reaction time on the substrate was also investigated by the assay procedure described above with constant concentration of CAT-VEGF conjugate in different reaction times of 2-120 sec.
10
Optimized Chemiluminescent ELISA for VEGF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Several physicochemical factors that in uenced the chemiluminescent ELISA performance were carefully optimized in this work. In order to evaluate the in uence of CAT-VEGF conjugate, direct ELISA was performed as follows: The 96-well plates were rst coated with 100 µL of anti-VEGF monoclonal antibody (1 µg mL - 1 ) in PBS (pH 7.0) and incubated overnight at 4 °C. After washing thrice with PBST (PBS buffer containing 0.05% Tween 20, pH 7.0), 300 mL of BSA solution (1.0 mg mL - 1 ) was used to block the excess sites of the wells. After 2 h of incubation at 37 °C, the microplate was washed with the same procedure. Subsequently, 100 mL of different dilution of CAT-VEGF conjugate in PBS was added into the wells for 2 h at 37 °C. After washing thrice with PBST and once with PBS, 100 µL of 300 mM H 2 O 2 in 0.01 M PB (pH 7.0) was injected for 1 min. Finally, 100 µL of TGA-CdTe QDs was injected into the well and the CL signals of the TGA-CdTe QDs were measured by using Berthold luminometer (Titertek-Berthold, Sirius L, Pforzheim, Germany). The effect of the enzyme reaction time on substrate was also investigated by the assay procedure described above with constant concentration of CAT-VEGF conjugate in different reaction time of 2-120 sec.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!