Sybr premix dimer eraser

Total RNAs were extracted from cultured cells or human tissues with TRIzol reagent according to the manufacturer’s instruction (Invitrogen). The RNAs were reversely transcribed using the PrimeScript RT Reagent Kit (Takara, Japan). The housekeeping gene GAPDH was used as an internal control. The primers were as follows: SPRED1 forward primer, 5’-GAGGGAGTGGACTAAGCAGC-3′; SPRED1 reverse primer, 5′-CCTCTATCAAAAGCCCTAGCATC-3′; GAPDH forward primer, 5′-CCACCCATGGCAAATTCCATGGCA-3′; GAPDH reverse primer, 5′-TCTAGACGGCAGGTCAGGTCCACC -3′. To measure the expression levels of miR-196a, the stem-loop specific primer method was used as previously described [24 (link), 25 (link)]. Quantitative reverse transcriptase (qRT) PCR primers were the following: miR-196a RT primer, 5′- GTCAGAAGGAATGATGCACAGCCAACAACA-3′; miR-196a PCR primers, sense: 5′-ACCTGCGTAGGTAGTTTCATGT-3′; antisense: 5′-CGTCAGAAGGAATGATGCACAG-3′. U6 RT primer: 5′-AACGCTTCACGAATTTGCGT-3′; U6 PCR primers sense: 5′-CTCGCTTCGGCAGCACA-3′; antisense: 5′-TGGTGTCGTGGAGTCG-3′. Quantitative RT-PCR was performed using SYBR Premix Dimer Eraser (Vazyme Biotech co.,ltd, China) on a 7900HT system. GAPDH or U6 levels were used as an internal control, and fold changes were calculated by relative quantification (2^–ΔΔCt).

Total RNA isolation was performed via TRIzol Reagent (KCDR2001, Cronda). The collected RNAs were reversely transcribed by PrimeScript RT Reagent Kit (KCDR2001, Cronda). Then the Polymerase chain reaction (qPCR) was conducted on LightCycler® 480II (Roche) by using SYBR Premix DimerEraser (Q711-02, Vazyme). The relative gene expression was analyzed with the 2^−ΔΔCt methods. β-actin and U6 served as the internal reference for mRNA and miRNA, respectively. Sequences of primers are as follows: IRF2, forward: 5′-AGTACGGTGAACATCATAGTTG-3′, reverse: 5′-TGTCGGTAGTTTCGCTTT-3′; caspase 3, forward: 5′-ACAGCACCTGGTTACTATTC-3′, reverse: 5′- CAGTTCTTTCGTGAGCAT-3′; β-actin, forward: 5′-GTCCCTCACCCTCCCAAAAG-3′, reverse: 5′-GCTGCCTCAACACCTCAACCC-3′; miR-222-3p reverse primer: 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCCAGTA-3′; miR-222-3p, forward: 5′-GCACTAGCTACATCTGGC-3′; and U6, forward: 5′-CTCGCTTCGGCAGCACA-3′, reverse: 5′-AACGCTTCACGAATTTGCGT-3′.

Total RNA was isolated from cultured cells or human tissues with TRIzol reagent according to the manufacturer's instruction (Invitrogen). To determine the quantity of the mRNA levels of AKT2, total RNAs were reverse transcribed by oligodeoxythymidine primer using the PrimeScript RT Reagent Kit. The housekeeping gene GAPDH was used as an internal control. The primers were as follows: AKT2 forward primer, 5′- ACCACAGTCATCGAGAGGACC -3′;AK T2 reverse primer, 5′-GGAGCCACACTTGTAGTCCA-3′; GAPDH forward primer, 5′-CCACCCATGGCAAATTCC ATGGCA-3′; GAPDH reverse primer, 5′-TCTAGACGGCA GGTCAGGTCCACC-3′. To measure the expression levels of miR-124, the stem-loop specific primer method was used as described previously [43 (link), 44 (link)]. Quantitative reverse transcriptase (qRT) PCR primers were the following: miR-124 RT primer, 5′- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGCATTC-3′; miR-124 PCR primers, sense: 5′-ACACTCCAGCTGGGTAAGGCACGCGGTG-3′; antisense: 5′-TGGTGTCGTGGAGTCG-3′. U6 RT primer: 5′-AACGCTTCACGAATTTGCGT-3′; U6 PCR primers, sense: 5′-CTCGCTTCGGCAGCACA-3′; antisense: 5′-TGGTGTCGTGGAGTCG-3′. Quantitative RT-PCR was performed using SYBR Premix Dimer Eraser (Vazyme Biotech co., ltd) on a 7900HT system. GAPDH or U6 levels were used as an internal control, and fold changes were calculated by relative quantification (2^−ΔΔCt).