Rna cleanup kit

Axolotl specific JunB probes were created by PCR amplification with the addition of the T7 and Sp6 promoter into the PCR primers:
T7 JunB ISH For 5′-AGAtaatacgactcactatagggAATGTGCCGTGCAGCGGATA-3′
Sp6 JunB ISH Rev 5′-AGAtatttaggtgacactatagAAGAGGTAGAGGGAGCCCAGTC-3′
The resulting PCR product was used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymyerase T7 or Sp6 (NEB). Probes were purified with RNA Clean Up kit (Qiagen) and resuspended in 100 μL of hybridization buffer.
Primers for other genes (5′–3′):
Vimentin ISH Forward ACAAGTCAAAGTTCGCTGAT
Vimentin ISH Reverse CCATCTCTGGTCTCAACAGT
NG2 ISH Forward CTTACTGTCGACGAGGAGAC
NG2 ISH Reverse TCGGGCTGTTGTACTATCTT
Galectin-1 Forward TAGGGGTCATGTGACTTTTC
Galectin-1 Reverse AGGCAACTAGTCCAGTTTGA
The PCR fragment was subcloned into pGemTEasy vector. The plasmid was then linearized and used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymyerase T7 or Sp6 (NEB). Probes were purified with RNA Clean Up kit (Qiagen) and resuspended in 100 μL of hybridization buffer.

The plasmid constructs containing full-length HEV genome (pSHEV-3 cDNA clone of HEV genotype 3 accession number-AY575859.1, a kind gift from SU Emerson, NIH, USA) and sub-genomic HEV carrying luciferase gene (GenBank accession number JQ679013) were used to prepare in vitro transcripts. The full-length cDNA and HEV replicon carrying the Renilla luciferase gene was linearized using XbaI and MluI, respectively. The linearized DNA was purified using the column purification method (Qiagen, Germany). Briefly, 5 μg of linearized DNA was used for in vitro transcription [41 (link)], and the reaction was performed in 50 μL of reaction mixture containing 1× transcription buffer (Promega, Madison, WI, USA). The reaction mix consisted of 0.5 mM concentration of nucleoside triphosphates (ATP, CTP and UTP and 0.05 mM concentration of GTP (Promega, WI, USA), 5 mM DTT, 2 μL of RNasin (10 U/mL) and T7 RNA polymerase (10U/mL) (Promega, WI, USA). The reaction was performed at 37 °C for 2 h, and 1 μL of T7 RNA polymerase was added after an hour. The RNA was capped using a 0.5 mM Ribom⁷G cap analogue (Promega, Madison, WI, USA), and the transcripts were purified using an RNA cleanup kit (Qiagen, Germany).

Total RNA was extracted from the left ventricular myocardial tissues of three genotypes (Tg-E22K, Tg-WT, and Non-Tg) using Trizol reagent (Thermo Fisher Scientific, Catalog #15596026). After treatment with DNASE-I (New England Biolabs, Catalog #M0303S) to remove genomic DNA, total RNA was cleaned with RNA clean-up Kit (Qiagen, Catalog #74204). cDNA synthesis was conducted with PrimeScript TM RT Master Mix (RR036A, Tkara, China) reaction system according to the manufacturer's instructions. Real-time PCR amplification was conducted by TB Green Premix Ex TaqTM II (RR820A, Tkara, China) reaction system using the primers listed in Table 1 (24 (link)). The 2^−ΔΔCt method was used for the relative quantification of gene expression, standardized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the invariant control for the sample, and then compared with the reference sample.