In order to characterize the 20 isolates obtained from the forest soil using ARDRA, genomic DNA was extracted from the actively-growing cultures grown in LB broth, followed by total DNA extraction using the CTAB method. The DNA concentration was estimated, and the purity was determined using agarose gel electrophoresis. Appropriately diluted (20 ng.µL− 1) DNA was used for the amplification of the 16 S rDNA gene. The forward and reverse primers used were: 27f AGAGTTTGATCCTGGCTCAG and 1492r ACGGYTACCTTGTTACGACTT. The PCR reactions were performed in 20 µL PCR mixture, including 1X Taq buffer, 2.5 mM MgCl2, 0.5 µM of forward and reverse primers each, 0.25 mM dNTP mixture, and 3 U of Pfu DNA Polymerase (all from Fermentas, USA). The PCR conditions were: initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C, each for 1 min; annealing at 55 °C for 1 min; primer extension at 72 °C for 1 min followed by the final extension at 72 °C for 10 min. Amplification was performed in BioRad T100 PCR. The presence of the 1.5-kb PCR product size was visualized using 1.2 % agarose gel electrophoresis.
T100 pcr
Manufactured by Bio-Rad
Sourced in United States
The T100 PCR is a thermal cycler designed for performing polymerase chain reaction (PCR) experiments. It is capable of precisely controlling temperature and cycling parameters to facilitate DNA amplification and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Pfu dna polymerase, by Thermo Fisher Scientific (1 mentions)
Dynamic light scattering, by Malvern Panalytical (1 mentions)
Tryptone, by Thermo Fisher Scientific (1 mentions)
Kta pure, by GE Healthcare (1 mentions)
Rf 6000 spectrofluorophotometer, by Shimadzu (1 mentions)
Proteonavi c4 column, by Shiseido (1 mentions)
J 810 circular dichroism spectrometer, by Jasco (1 mentions)
H 600 transmission electron microscope, by Hitachi (1 mentions)
Zetasizer nano zs90, by Malvern Panalytical (1 mentions)
Tskgel g3000swxl, by Tosoh (1 mentions)
Electrotransfer system, by Bio-Rad (1 mentions)
Agilent 1200 liquid chromatography system, by Agilent Technologies (1 mentions)
Am 400, by Bruker (1 mentions)
Drx 500, by Bruker (1 mentions)
Avance 3 600, by Bruker (1 mentions)
Gel extraction kit, by Qiagen (1 mentions)
Truseq dna pcr free sample preparation kit, by Illumina (1 mentions)
Novaseq 6000 pe250, by Illumina (1 mentions)
Taq polymerase, by Thermo Fisher Scientific (1 mentions)
Taq buffer, by Thermo Fisher Scientific (1 mentions)
5 protocols using t100 pcr
1
ARDRA-based Characterization of Forest Soil Isolates
2
Purification and Characterization of Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast extract and tryptone were purchased from Oxoid and the other reagents were of analytical grade. Pre‐packed Capto Butyl column (Hiscreen, 1 × 4.7 mL) was purchased from Cytiva (USA). T‐100 PCR from BioRad (USA), T&J‐A type 10‐L fermentor (T&J Bio‐engineering, China), AH‐NANO (ATS, China), ÄKTA pure (GE healthcare, USA), HPLC Agilent 1100 (USA), Proteonavi C4 column (Shiseido, Japan), TSKgel G3000SWxl (TOSOH, Japan), Zetasizer Nano ZS90 (Malvern Panalytical, UK), H‐600 Transmission electron microscope (Hitachi, Japan), Differential scanning calorimetry (GE Healthcare, USA), J‐810 circular dichroism spectrometer (Jasco, Japan), RF‐6000 spectro fluorophotometer (Shimadzu, Japan), and Dynamic light scattering (Malvern Panalytical, UK).
3
Instrumental Characterization of Chemical Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1D and 2D NMR were recorded on Bruker AM-400, Bruker DRX-500 or Avance III-600 spectrometers (Bruker, Bremerhaven, Germany). Mass spectra were run on a Waters HPLC-Thermo Finnigan LCQ Advantage ion trap mass spectrometer (Milford, PA). Silica gel (100–200 mesh, 200–300 mesh) for column chromatography and TLC plates (GF254) were obtained from Qingdao Haiyang Chemical Company (Haiyang, Qingdao, China). Sephadex LH-20 (40–70 μm) for column chromatography was purchased from Amersham Pharmacia Biotech AB (Uppsala, Sweden). HPLC was carried out on Agilent 1200 liquid chromatography system (Agilent Technologies, Santa Clara, CA, USA) equipped with diode array detector (DAD). Fractions were visualized by silica gel plates sprayed with dragendorff’s reagent. SDS-PAGE and Western-blot were carried out using a Bio-Rad electro transfer system. RT-PCR was measured by Bio-Rad T100™ PCR.
4
Bacterial 16S rRNA Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA extraction was completed by means of the cetyltrimethylammonium bromide (CTAB) method [93 (link)]. DNA concentration and purity were detected via 1% agarose gels. PCR amplification was carried out for V3-V4 variable regions in 16S rRNA genes of bacteria based on the primers 341F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACNNGGGTATCTAAT-3′). The sequencing data have been deposited in the Sequence Read Archive (SRA) of the National Center for Biotechnology Information (NCBI) (Bioproject: PRJNA837553), to be released upon publication. The corresponding amplification procedure was as follows: predenaturation at 98°C for 1 min→30 cycles (degeneration at 98°C for 10 s, followed by annealing at 50°C for 30 s and extension at 72°C for 30 s successively)→ extension at 72°C for 5 min (PCR amplifier: T100PCR, Bio-Rad, USA). Then, 2% agarose gel electrophoresis was performed to detect PCR products, and a Qiagen Gel Extraction Kit (Qiagen, Germany) was utilised for purification. Finally, a TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, USA) was applied to create a library, and sequencing was conducted on an Illumina NovaSeq 6000 PE250 (Novogene, Tianjin, China).
5
Screening Bt Isolates for Cry Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total genomic DNA from Bt isolates was extracted, using appropriate methods (Sambrook and Russell 2001) . The nematode-specific cry gene primers were used to identify the cry5, cry6, cry14 and cry21 gene families in Bt isolates (Porcar and Juárez-Pérez 2003) (link).
The 25 μl PCR reaction mixture consisted of 1X Taq buffer, 2.5 mM MgCl2, 0.5 μM forward and reverse primers, 0.25 mM dNTP mixtures and 3 U of Taq polymerase (all from Fermentas, USA). PCR condition includes 95 °C for 5 min (initial denaturation), 35 cycles of 95 °C for 1 min (denaturation), 55 °C for 1 min (annealing), 72 °C for 1 min (primer extension), followed by 72 °C for 10 min (final extension). Amplification was performed in Biorad T100 PCR. Four reference strains of Bt, 4 M1, 4Q1, 4E1 and 4BG1 obtained from Bacillus Genetic Stock Centre (BGSC), the Ohio State University, Columbus, Ohio 43210, were used as a positive control for screening of native Bt isolates by PCR.
The 25 μl PCR reaction mixture consisted of 1X Taq buffer, 2.5 mM MgCl2, 0.5 μM forward and reverse primers, 0.25 mM dNTP mixtures and 3 U of Taq polymerase (all from Fermentas, USA). PCR condition includes 95 °C for 5 min (initial denaturation), 35 cycles of 95 °C for 1 min (denaturation), 55 °C for 1 min (annealing), 72 °C for 1 min (primer extension), followed by 72 °C for 10 min (final extension). Amplification was performed in Biorad T100 PCR. Four reference strains of Bt, 4 M1, 4Q1, 4E1 and 4BG1 obtained from Bacillus Genetic Stock Centre (BGSC), the Ohio State University, Columbus, Ohio 43210, were used as a positive control for screening of native Bt isolates by PCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!