Log In Sign up
The largest database of trusted experimental protocols

Rneasy mini system

Manufactured by Qiagen
Visit Supplier
Sourced in United Kingdom, Germany

The RNeasy Mini system is a nucleic acid extraction and purification tool designed for the isolation of high-quality RNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify RNA, allowing for its subsequent analysis and downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Sybr premix ex taq kit, by Takara Bio (5 mentions) Iscript reagent, by Bio-Rad (4 mentions) Quantifast, by Qiagen (3 mentions) Quantitect, by Qiagen (3 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Lightcycler 480, by Roche (2 mentions) Dna blood mini kit, by Qiagen (2 mentions) Bioanalyzer, by Agilent Technologies (2 mentions) 2100 bioanalyzer, by Agilent Technologies (1 mentions) Mirneasy kit, by Qiagen (1 mentions) Superscript 3 rt, by Thermo Fisher Scientific (1 mentions) Polytron tissue homogenizer, by Kinematica (1 mentions) Bioanalyzer 2100 system, by Agilent Technologies (1 mentions) Gotaq system, by Promega (1 mentions) Superscript 3 system, by Thermo Fisher Scientific (1 mentions) Ethidium bromide, by Merck Group (1 mentions) Rneasy minelute kit, by Qiagen (1 mentions) Rnase free dnase 1, by Roche (1 mentions) Hiseq 4000, by Illumina (1 mentions)

18 protocols using rneasy mini system

1

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from 30-50mg tissue samples previously stored in RNAlater at -80°C, using a combination of TRIzol™ reagent (Invitrogen) and Qiagen RNeasy Mini system (Qiagen, UK) according to both manufacturers’ instructions. gDNA decontamination, reverse transcription and real time PCR were performed using reagents and primers (Quantifast and Quantitect respectively, Qiagen, UK) on an ABI Prism 7500 cycler, except for chemokine/chemokine receptor analysis which was performed as previously described (56 (link)). Data were collected using the LightCycler system following normalization to the housekeeping gene peptidylprolyl isomerase A (Ppia); or Gapdh for chemokine/chemokine receptor data. All samples were run in triplicates.
Bird T.G., Müller M., Boulter L., Vincent D.F., Ridgway R.A., Lopez-Guadamillas E., Lu W.Y., Jamieson T., Govaere O., Campbell A.D., Ferreira-Gonzalez S., Cole A.M., Hay T., Simpson K.J., Clark W., Hedley A., Clarke M., Gentaz P., Nixon C., Bryce S., Kiourtis C., Sprangers J., Nibbs R.J., Van Rooijen N., Bartholin L., McGreal S.R., Apte U., Barry S.T., Iredale J.P., Clarke A.R., Serrano M., Roskams T.A., Sansom O.J, & Forbes S.J. (2018). TGFβ inhibition restores a regenerative response in acute liver injury by suppressing paracrine senescence. Science translational medicine, 10(454), eaan1230.
+ Open protocol
+ Expand
2

Genomic and Transcriptomic Analysis of Liver Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA (gDNA) was extracted from purified cell populations using whole liver using DNA Blood Mini Kit (Qiagen UK). Total RNA was extracted from 30-50mg tissue samples previously stored in RNAlater at −80°C or cultured cells, using a combination of TRIzol™ reagent (Invitrogen) and Qiagen RNeasy Mini system according to manufacturer’s instructions (Qiagen, UK). Reverse Transcription (including gDNA decontamination) and real time PCR was performed using reagents and primers (Quantifast and Quantitect respectively, Qiagen, UK) on a Roche Lightcycler 480. Mdm2flox integrity of gDNA was assessed using primers targeted to the floxed segment (Forward: ACGAGAAGCAGCAGCACATTG, Reverse: TTATAACCCACCACGCACAAGG) and a reference segment adjacent to Exon 3 (Forward: AACCTGGATTATCGCACAGTCG, Reverse: TCGCAGTGACCACTCTCTAATGC). cDNA was prepared from purified cell populations using Data were analysed using the LightCycler system following normalization to the housekeeping gene peptidylprolyl isomerase A (Ppia). All samples were run in triplicate.
Lu W.Y., Bird T.G., Boulter L., Tsuchiya A., Cole A.M., Hay T., Guest R.V., Wojtacha D., Man T.Y., Mackinnon A., Ridgway R.A., Kendall T., Williams M.J., Jamieson T., Raven A., Hay D.C., Iredale J.P., Clarke A.R., Sansom O.J, & Forbes S.J. (2015). Hepatic progenitor cells of biliary origin with liver repopulation capacity. Nature cell biology, 17(8), 971-983.
+ Open protocol
+ Expand
3

Genomic and Transcriptomic Analysis of Liver Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA (gDNA) was extracted from purified cell populations using whole liver using DNA Blood Mini Kit (Qiagen UK). Total RNA was extracted from 30-50mg tissue samples previously stored in RNAlater at −80°C or cultured cells, using a combination of TRIzol™ reagent (Invitrogen) and Qiagen RNeasy Mini system according to manufacturer’s instructions (Qiagen, UK). Reverse Transcription (including gDNA decontamination) and real time PCR was performed using reagents and primers (Quantifast and Quantitect respectively, Qiagen, UK) on a Roche Lightcycler 480. Mdm2flox integrity of gDNA was assessed using primers targeted to the floxed segment (Forward: ACGAGAAGCAGCAGCACATTG, Reverse: TTATAACCCACCACGCACAAGG) and a reference segment adjacent to Exon 3 (Forward: AACCTGGATTATCGCACAGTCG, Reverse: TCGCAGTGACCACTCTCTAATGC). cDNA was prepared from purified cell populations using Data were analysed using the LightCycler system following normalization to the housekeeping gene peptidylprolyl isomerase A (Ppia). All samples were run in triplicate.
Lu W.Y., Bird T.G., Boulter L., Tsuchiya A., Cole A.M., Hay T., Guest R.V., Wojtacha D., Man T.Y., Mackinnon A., Ridgway R.A., Kendall T., Williams M.J., Jamieson T., Raven A., Hay D.C., Iredale J.P., Clarke A.R., Sansom O.J, & Forbes S.J. (2015). Hepatic progenitor cells of biliary origin with liver repopulation capacity. Nature cell biology, 17(8), 971-983.
+ Open protocol
+ Expand
4

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from sub-confluent cell cultures (65%) using the RNeasy-mini system (Qiagen, Venlo, The Nederlands). Typically, 1 μg of RNA from independent samples was retro-transcribed using iScript reagents (Bio-Rad, Hercules, CA, USA). Resulting cDNA was used for quantitative PCR (qPCR) implementing the SYBR premix ex Taq kit (Takara Bio Europe/Clontech, Saint-Germain-en-Laye, France) according to manufacturer’s instructions. For each mRNA, gene expression levels were normalized to the Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) content of each sample by applying the comparative Cq method (2−∆∆Cq). Primers used are detailed in Table S1. Replicates from three independent experiments were quantified. Analyzed data represent mean ± SEM.
Liarte S., Bernabé-García Á, & Nicolás F.J. (2020). Human Skin Keratinocytes on Sustained TGF-β Stimulation Reveal Partial EMT Features and Weaken Growth Arrest Responses. Cells, 9(1), 255.
+ Open protocol
+ Expand
5

Tissue-Based Analysis of CYFIP1 Duplication in ASD

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Seven ASD individuals with maternally derived CYFIP1 containing 15q11-13 duplications and six typically developing non-carrier controls were identified within the Autism Genetic Resource Exchange (AGRE) [31 (link), 43 (link), 44 (link)], Non-AU samples from Dr. N. Schanen (http://www.bio.udel.edu/users/cschanen) and frozen aliquots of EBV transformed lymphoblastoid cell lines were acquired (Supplemental Material, Table S1). Total RNA from lymphoblastoid cell lines, seeded at 9 × 10^6 and harvested 24 hours later, was obtained using the RNeasy Mini system with DNase treatment (Qiagen). RNA quantity and quality were measured with a ND-100 (Nanodrop) and Bioanalyzer 2100 (Agilent), respectively. Three separate individual with ASD with maternally derived CYFIP1 containing 15q11-13 duplications and five typically developing non-carrier controls were identified from the Autism Tissue Program cohort organized by Autism Speaks and the Harvard Brain Bank [45 (link)]; tissue samples from the superior temporal gyrus (STG, also known as Brodmann’s area 41/42) were obtained (Supplemental Material, Table S2). RNA was obtained using the miRNeasy kit (Qiagen) and quantity and quality assessed as described above. Clinical information for all cases is available from AGRE and the ATP, respectively.
Oguro-Ando A., Rosensweig C., Herman E., Nishimura Y., Werling D., Bill B., Berg J., Gao F., Coppola G., Abrahams B, & Geschwind D. (2014). Increased CYFIP1 dosage alters cellular and dendritic morphology and dysregulates mTOR. Molecular psychiatry, 20(9), 1069-1078.
+ Open protocol
+ Expand
6

Quantitative analysis of gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sub-confluent cells (50%) serum-deprived for 24 hours were treated with OA for 6 and 24 hours and RNA was extracted using the RNeasy-mini system (Qiagen, Venlo, The Nederlands). Typically, 1 μg of RNA from independent samples was retro-transcribed using iScript reagents (Bio-Rad, Hercules, CA, USA), and resulting cDNA was used for quantitative PCR (qPCR) using the SYBR premix ex Taq kit (Takara Bio Europe/Clontech, Saint-Germain-en-Laye, France) according to the manufacturer’s instructions. For each mRNA, gene expression levels were normalized to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) content of each sample by applying the comparative Cq method (2-∆∆Cq). Two samples of three independent experiments were quantified by qPCR, analysed data represent mean ± SEM. Primers used for gene amplification are detailed in Table 1.
Bernabé-García Á., Armero-Barranco D., Liarte S., Ruzafa-Martínez M., Ramos-Morcillo A.J, & Nicolás F.J. (2017). Oleanolic acid induces migration in Mv1Lu and MDA-MB-231 epithelial cells involving EGF receptor and MAP kinases activation. PLoS ONE, 12(2), e0172574.
+ Open protocol
+ Expand
7

Isolation and Purification of Parotid Gland RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Parotid gland biopsies were snap-frozen in liquid nitrogen after surgery and cryo-preserved at −80°C until use. RNA was isolated from parotid gland samples using a polytron tissue homogenizer (Kinematica AG, Littau-Lucerne, Switzerland) in the presence of STAT60 RNA reagent (Tel-test Inc., Friendswood, TX, USA) according to the manufacturer’s protocol. After isolation RNA was purified using the RNeasy Mini System [Clean-up-protocol (#74106, Qiagen, Venlo, the Netherlands)]. RNA quality was checked using the Bioanalyzer 2100 system (Agilent) and quantified using the Qubit1.0-platform (#Q32857, Invitrogen Life Technologies, Breda, the Netherlands). cDNA was synthesized using Superscript RT-III and oligo-dT primers according to the manufacturer’s protocol (#18080-051, Invitrogen).
Visser A., Doorenspleet M.E., de Vries N., Spijkervet F.K., Vissink A., Bende R.J., Bootsma H., Kroese F.G, & Bos N.A. (2018). Acquisition of N-Glycosylation Sites in Immunoglobulin Heavy Chain Genes During Local Expansion in Parotid Salivary Glands of Primary Sjögren Patients. Frontiers in Immunology, 9, 491.
+ Open protocol
+ Expand
8

Adhesion Molecule Gene Expression in Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The gene expression of adhesion molecules was performed in serum-starved cells (medium with 0.5% FBS) that had been incubated for 24 h with AM and then treated with TNF-α (1 ng/ml) for 2, 6, or 24 h. Following treatments, RNA was extracted using the RNeasy-mini system (Qiagen). Afterward, 1 µg of RNA was retro-transcribed using iScript reagents (Bio-Rad). The resulted cDNA was used to perform a quantitative real-time PCR (RT-PCR) using the SYBR premix ex Taq kit (Takara Bio Europe) according to the manufacturer’s instructions to analyze the inflammation-associated genes (Table 1). Each analysis was normalized with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene expression according to the 2-ΔΔCt method. The experiment was carried out on three different strains for C-HUVECs and three different strains for GD-HUVECs, each in technical triplicate.
Pipino C., Bernabé-García Á., Cappellacci I., Stelling-Férez J., Di Tomo P., Santalucia M., Navalón C., Pandolfi A, & Nicolás F.J. (2022). Effect of the Human Amniotic Membrane on the Umbilical Vein Endothelial Cells of Gestational Diabetic Mothers: New Insight on Inflammation and Angiogenesis. Frontiers in Bioengineering and Biotechnology, 10, 854845.
+ Open protocol
+ Expand
9

Quantification of mRNA Levels in hNPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from hNPCs or differentiated cells using the RNeasy mini system (Qiagen, Hilden, Germany). Isolated RNA was treated with RNAse-free DNAseI (Roche) to remove genomic DNA. Samples were cleaned up using the RNeasy minelute kit (Qiagen) and RNA quantity and quality was determined by spectrophotometry. RNA (1 μg) was retro-transcribed using the Superscript III system (Life Technologies) according to manufacturer's instructions. PCR was carried out using the GoTaq system (Promega, Madison, WI, USA) according to manufacturer's instructions. Primer sequences are indicated in Supplementary Table 3. PCR products were separated on 1.5% agarose gel containing 200 μg/ml ethidium bromide (Sigma), and visualized using a GelDoc-IT UV imaging system (UVP, Upland, CA, USA). PCR band intensity was analyzed by densitometry using ImageJ software and mRNA levels were normalized to the GAPDH mRNA. The mean of three different experiments was plotted and transcript level expressed as arbitrary units.
Rinaldi F., Hartfield E.M., Crompton L.A., Badger J.L., Glover C.P., Kelly C.M., Rosser A.E., Uney J.B, & Caldwell M.A. (2014). Cross-regulation of Connexin43 and β-catenin influences differentiation of human neural progenitor cells. Cell Death & Disease, 5(1), e1017-.
+ Open protocol
+ Expand
10

Human Islet Transcriptomic Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
We isolated RNA using the RNeasy Mini system (Qiagen) from a total of 16 samples of human islets including n = 4 distinct islet donors exposed for 24 h to either high-dose three cytokine, high-dose two cytokine or untreated conditions, and n = 2 distinct islet donors exposed for 24 h to low-dose three cytokine or low-dose two cytokine conditions. Approximately 500–1000 islets were used for RNA isolation per sample. The RNA quality was assessed using a 2200 TapeStation to confirm RNA integrity, and all samples had a RIN score of >7. Ribodepleted total RNA libraries were prepared using TruSeq Stranded Total RNA Library Prep Gold (Cat#20020599) and sequenced at the UCSD Institute for Genomic Medicine on an Illumina HiSeq 4000 using paired-end reads of 100 bp to an average of 34.5 M read pairs sequenced per sample.
Benaglio P., Zhu H., Okino M.L., Yan J., Elgamal R., Nariai N., Beebe E., Korgaonkar K., Qiu Y., Donovan M.K., Chiou J., Wang G., Newsome J., Kaur J., Miller M., Preissl S., Corban S., Aylward A., Taipale J., Ren B., Frazer K.A., Sander M, & Gaulton K.J. (2022). Type 1 diabetes risk genes mediate pancreatic beta cell survival in response to proinflammatory cytokines. Cell Genomics, 2(12), 100214.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!