Taq pcr mix

The BSF COI sequences were also utilised to compare with the conventional PCR method. The 25 μL PCR reaction included 12.5 μL of Taq PCR Mix (B532081, Sangon Biotech Co., Ltd., Shanghai, China), 1 μL of DNA template, 1 μL of each primer (Table 1), 7.5 μL of reaction mix, and 0.4 μL of DNA polymerase. The PCR cycle processes were as follows: 3 min at 94 °C; 35 cycles of 30 s at 95 °C, 30s at 55 °C, and 45s at 72 °C; and a 7-min extension at 72 °C. 1.5% agarose gel electrophoresis was used to detect the PCR amplification products.

Quantitative real-time PCR analyses were performed on a CFX connect system (Bio-Rad Laboratories) with Taq PCR Mix (Sangon Biotech, Shanghai, China). The following cycling conditions were used: 95 °C for 150 s; 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 60 s; followed by 72 °C for 10 min. Three biological replicates were completed for all samples. The primers for hsa-miR-1290 were as follows: forward, 5′-GCGCGTGGATTTTTGGAT-3′; reverse, 5′-AGTGCAGGGTCCGAGGTATT-3′; and probe, 5′-FAM-CGCACTGGATACGACTCCCT-TAMRA-N-3′ (Sangon Biotech, Shanghai, China). The primers for hsa-miR-16-5p were as follows: forward, 5′- CGCGTAGCAGCACGTAAATA-3′; reverse, 5′- AGTGCAGGGTCCGAGGTATT − 3′; and probe, 5′-FAM-CGCACTGGATACGACCGCC-TAMRA-N-3′ (Sangon Biotech, Shanghai, China). The primers for cel-miR-39 were as follows: forward, 5′-GGCGTCACCGGGTGTAAA-3′; reverse, 5′- AGTGCAGGGTCCGAGGTATT-3′; and probe, 5′-FAM-CAGCTTGGTCGTATCCAGTGCG-TAMRA-N-3′ (Sangon Biotech, Shanghai, China). The primers for U6 were as follows: forward, 5′- GCTTCGGCAGCACATATACTAAAAT-3′; reverse, 5′- CGCTTCACGAATTTGCGTGTCAT-3′; and probe, 5′-FAM- CAGAGAAGATTAGCATGGCCCCTG-N-3′ (Sangon Biotech, Shanghai, China). Finally, the expression level of miR-1290 was analyzed using the 2^-ΔΔCt method, with hsa-miR-16-5p and cel-miR-39 serving as internal and exogenous controls, respectively.

DNA was extracted from C. albicans using OMEGA D3370 yeast DNA extraction kit (Guangzhou Feyou Biotechnology Co., Ltd) following the manufacturer's instructions. The primer sequences of ERG11 and SAP2 were shown in Table 1, and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The volume of polymerase chain reaction (PCR) system was 25 μl, including 2X TaqPCR Mix 12.5 μl, forward primer 1 μl, reverse primer 1 μl, DNA 2.5 μl, and double distilled water 8 μl. The PCR reaction was initiated at 94°C for 10 min, followed by 94°C for 45 s, 52°C/48.5°C (SAP2/ERG11) for 45 s, and 72°C for 2 min, for a total of 30 cycles, and finally ended at 72°C for 10 min.
The PCR products were purified and two directional sequenced by Sangon Biotech (Shanghai) Co., Ltd. The gene sequences of the PCR products were analyzed by Blast software, and then were compared with the known sequences in GenBank database (NC032096/X13296). Additionally, the sequences are translated into amino acid sequences to identify gene mutation sites by chromas and secentral softwares.