The IECs were isolated from jejunum (mid gut) using a modified protocol adapted from Paim et al. [25 (link),34 (link),45 (link)]. The viability and numbers of IECs were determined by the trypan blue exclusion method (70–80%). qRT-PCR was performed using equal amounts of total RNA (75 ng) with Power SYBR Green RNA-to-CT 1 step RT-PCR kit (Applied Biosystems, Foster, CA, USA). The gene-specific primers for enteroendocrine cells (chromogramin A (CgA)), goblet cells (mucin 2 (MUC2)), transient amplifying progenitor cells (proliferating cell nuclear antigen (PCNA)), intestinal epithelial stem cells (transcription factor SRY-box9 (SOX9)), enterocytes (villin), and β-actin were based on previously published data [25 (link),46 (link),47 (link),48 (link)]. Relative gene expressions of CgA, MUC2, PCNA, SOX9, and villin were normalized to β-actin and expressed as fold change using the 2−ΔΔCt method [49 (link)].
Power sybr green rna to ct 1 step rt pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Power SYBR Green RNA-to-CT 1 step RT-PCR kit is a reagent kit designed for one-step reverse transcription and real-time PCR amplification of RNA targets. The kit includes all the necessary components for reverse transcription and real-time PCR in a single reaction, enabling efficient and streamlined RNA quantification.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy microrna isolation kit, by Qiagen (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Direct zol rna miniprep, by Zymo Research (1 mentions)
Superscript 4 vilo, by Thermo Fisher Scientific (1 mentions)
5 protocols using power sybr green rna to ct 1 step rt pcr kit
1
Isolation and Characterization of Intestinal Epithelial Cells
2
Quantitative gene expression analysis of intestinal cell populations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was performed using equal amounts of total RNA (75 ng) with Power SYBR Green RNA-to-CT 1 step RT-PCR kit (Applied Biosystems, Foster, CA, USA). The primers for enteroendocrine cells chromogramin A (CgA), goblet cells mucin 2 (MUC2), transient amplifying progenitor cells proliferating cell nuclear antigen (PCNA), intestinal epithelial stem cells transcription factor SRY-box9 (SOX9), enterocytes (villin) and β-actin were based on previously published data [18 (link), 39 (link)–41 (link)]. Relative gene expression of CgA, MUC2, PCNA, SOX9 and villin were normalized to β-actin and expressed as fold change using the 2-ΔΔCt method [50 (link)].
3
Quantitative Analysis of Neural Lineage Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Confluent cells were collected using accutase and total RNA was extracted using RNeasy microRNA isolation kit (Qiagen, Cat No. 74004), with the samples digested with RNase-free DNase I to eliminate genomic DNA. RT-qPCR analysis was performed using Power SYBR Green RNA to CT 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA). The primers were predesigned qPCR assays for human genes (IDT, Coralville, IA) as follows: GAPDH (Assay ID: Hs.PT.39a.22214836), TFAP2A (Assay ID: Hs.PT.58.5602), SOX10 (Assay ID: Hs.PT.58.4891394), P75/NGFR (Assay ID: Hs.PT.58.4045496), HNK1/B3GAT1 (Assay ID: Hs.PT.58.2273334), TP53 (Assay ID: Hs.PT.58.39676686), PUMA (Assay ID: Hs.PT.58.39966045), CASP3 (Assay ID: Hs.PT.56a.25882379.g), SOX2 (Assay ID: Hs.PT.58.237897.g), DCX (Assay ID: Hs.PT.58.118505), PAX6 (Assay ID: Hs.PT.58.25914558), GFAP (Assay ID: Hs.PT.58.14980282), NEUROD1 (Assay ID: Hs.PT.58.38524795), HES1 (Assay ID: Hs.PT.58.4181121), VIMENTIN/VIM (Hs.PT.58.38906895).
4
Quantifying Gene Expression in IECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from IECs with Direct-Zol RNA Miniprep (Zymo Research, Irvine, CA) according to the manufacturer’s instructions. RNA concentration and purity were measured with a NanoDrop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE). Real-time qRT-PCR was performed with equal amounts of total RNA (75 ng) and the Power SYBR green RNA-to-CT 1 step RT-PCR kit (Applied Biosystems, Foster, CA). The primers for CgA, MUC2, PCNA, SOX9, villin, and β-actin were based on previously published data (58 (link)– (link)60 (link)). Relative CgA, MUC2, PCNA, SOX9, and villin gene expression was normalized to β-actin and expressed as fold change by the 2−ΔΔCT method (61 (link)).
5
Developmental Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the developmental expression analysis, total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA, and cDNAs were synthesized using Superscript IV VILO (Invitrogen, Cat#11756050). RT-qPCR was performed using TAQMAN FAST ADVANCED MMIX (Applied Biosystems, Cat#4444557) using custom designed Taqman Probes for Nppa (Assay ID: AP2XD4X), Nppb (Assay ID: APZTJJZ), Nppc (Assay ID: APWC2U2), Npr1 (Assay ID: APPRPKU), Npr2 (Assay ID: AP327PV), Npr3 (Assay ID: AP472AT) and Odc (Assay ID: APCFAEF).
For animal caps, total RNA was extracted from 12 explants using RNeasy microRNA isolation kit (Qiagen, Valencia, CA) and the RNA samples were digested with RNase-free DNase I to eliminate genomic DNA. RT-qPCR analysis was performed using Power SYBR Green RNA to CT 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA) using the following primer sets: Six1 (F:ctggagagccaccagttctc ; R: agtggtctccccctcagttt ), Eya1 (F: atgacaccaaatggcacaga ; R: gggaaaactggtgtgcttgt ), Sox10 (F:CTGTGAACACAGCATGCAAA ; R:TGGCCAACTGACCATGTAAA ), Snai2 (F: CATGGGAATAAGTGCAACCA ; R: AGGCACGTGAAGGGTAGAGA ) and Odc (F: ACATGGCATTCTCCCTGAAG ; R: TGGTCCCAAGGCTAAAGTTG ).
For animal caps, total RNA was extracted from 12 explants using RNeasy microRNA isolation kit (Qiagen, Valencia, CA) and the RNA samples were digested with RNase-free DNase I to eliminate genomic DNA. RT-qPCR analysis was performed using Power SYBR Green RNA to CT 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA) using the following primer sets: Six1 (F:
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!