Lightcycler480ii

Serum total RNA was isolated using the miRcute serum/plasma miRNA isolation kit (TianGen, Beijing, China) and reverse transcribed using a miRNA First‐Strand cDNA Synthesis kit (TianGen) according to the manufacturer's instructions. Because of the the lack of a stable endogenous serum miRNA, samples were spiked with a synthetic Caenorhabditis elegans mir‐39 miRNA mimic (cel‐mir‐39) as a control to monitor changes in RNA recovery. The real‐time qPCR was performed in a Roche LightCycler480II using the miRcute miRNA Detection Kit (TianGen). Relative expression of target miRNAs was calculated using the comparative 2^‐ΔΔCt method with external control. In virtue of the lack of a stable endogenous serum miRNA, samples were spiked with a synthetic C. elegans mir‐39 miRNA mimic (cel‐mir‐39) as a control to monitor changes in RNA recovery. cel‐mir‐39 was the external control. Primers for miR‐26a, miR‐30b, miR‐30c, miR99a, miR100, miR181a, and the external control were designed by the authors. Primer sequences of these miRs as follows:miR‐30b‐5p: 5'‐GCGTCCTGTAAACATCCTACACTCAGCT‐3'miR‐99a‐5p: 5'‐GCGTAACCCGTAGATCCGATCTTGTG‐3'miR‐100‐5p: 5'‐GCGTAACCCGTAGATCCGAACTTGTG‐3'miR‐181a‐5p: 5'‐GCGTCCAACATTCAACGCTGTCGGTGAGT‐3' The universal reverse primer and primers for miR‐26a and miR‐30c were purchased from TianGen (Beijing, China).