The sgRNA were designed using the Crispor V4.3. software (23 (link); http://crispor.tefor.net/ ), their target sequence being GTTTGTTAATTCTCGACCGG(AGG) and CTGCTCGACAATTTCACCAG(AGG) in Medtr5g005120.1 and Medtr5g005050.2 (the 3 nucleotides in parenthesis correspond to the PAM sequence). The RNA guides provided by Integrated DNA Technologies were rehydrated and complexed using IDT Nuclease-Free Duplex Buffer following the supplier recommendations at 300 ng/μl. Before starting the Cas9 digestion reaction, the plugs were washed in fresh TE during 1 h at room temperature with agitation at 450 rpm, as recommended in (14 (link)). Each plug was then cut into 32 pieces and pre-incubated in 2 ml of 1× Cas9 nuclease reaction buffer (New England Biolabs) at room temperature with agitation at 450 rpm during 30 min. In parallel, 12 μg of each sgRNA was pre-incubated with 40 pmol of EnGen Cas9 NLS (20 μM, New England Biolabs) in 1× Cas9 reaction buffer at 25°C during 30 min. The two sgRNA complexes were finally incubated with gDNA in the plugs during 2 h at 37°C. To stop Cas9 digestion, 240 μg of Proteinase K (20 mg/ml) was added and incubated during 3 h at 43°C. The plugs were eventually rinsed in 1× TE by overnight incubation at 4°C.
Engen cas9 nls
Manufactured by New England Biolabs
Sourced in Japan, United States
The EnGen Cas9 NLS is a recombinant Cas9 protein with a nuclear localization signal (NLS) for efficient nuclear delivery. It is designed for use in CRISPR-Cas9 genome editing applications.
Automatically generated - may contain errors
Lab products found in correlation
Megashortscript t7 transcription kit, by Thermo Fisher Scientific (3 mentions)
Microspin g 50 column, by GE Healthcare (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Cas9 nuclease reaction buffer, by New England Biolabs (1 mentions)
Mmessage mmachine sp6 transcription kit, by Thermo Fisher Scientific (1 mentions)
Mmessage mmachine kit, by Thermo Fisher Scientific (1 mentions)
T7 in vitro transcription kit, by New England Biolabs (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Jetpei, by Polyplus Transfection (1 mentions)
Lipofectamine crisprmax, by Thermo Fisher Scientific (1 mentions)
Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (1 mentions)
Rna cleanup kit, by New England Biolabs (1 mentions)
Engen sgrna template oligo designer, by New England Biolabs (1 mentions)
T4 dna polymerase, by New England Biolabs (1 mentions)
16 protocols using engen cas9 nls
1
CRISPR-Cas9 Digestion of Genomic DNA
2
CRISPR/Cas9-Mediated Genome Editing in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9‐mediated genome editing in mice was performed as described previously, with some modifications [20 ]. Briefly, crRNA for the target sequence (5’‐ATTCGGTACCGAATCCCACC‐3’) and tracrRNA were synthesized by Fasmac Co., Ltd. (Kanagawa, Japan), and recombinant Cas9 protein (EnGen Cas9 NLS) was purchased from New England Biolabs Inc. (Ipswich, MA, USA). The crRNA (0.15 pmol·μL−1), tracrRNA (0.15 pmol·μL−1), and Cas9 protein (22.5 ng·μL−1) were co‐injected into the cytoplasm of fertilized eggs derived from C57BL/6J mice (Japan SLC, Hamamatsu, Japan). After the injected oocytes were cultured overnight in vitro, two‐cell embryos were transferred into pseudo‐pregnant female mice. Genomic DNA was isolated from tail samples of the offspring using standard methods. The edited region around exon 3 of the Cant1 gene was amplified by PCR, using the following primers: 5′‐GCCTCAGACTAAATGTTGTTCCAAGT‐3′ and 5′‐GAAATGGCGGACCAGCTGTTCTGA‐3′. The amplification products were sequenced, and their sequences were compared to the reference sequence.
3
CRISPR Gene Editing in Zebrafish setd2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic sequence of zebrafish setd2 gene was obtained from the National Center for Biotechnology Information. An online tool (ZiFit Targeter, http://zifit.partners.org/ZiFiT/Disclaimer.aspx ) was used to design guide RNA (gRNA) target sites in exon 3 and exon 19 containing 20-base pair (bp) target sequences (E3: cgtcaaaatgtgtttctacc; E19: ggcagacacgtccagtgagc). The predicted sequence was cloned into p-T7-gRNA vector backbone to generate the guide RNA expression construct. The specific single-guide RNAs (sgRNAs) was produced by in vitro transcription with the mMESSAGE mMACHINE SP6 Transcription Kit (Thermo Fisher, AM1340). The sgRNA (10 ng/μL) and Cas9 protein (200 ng/mL) (EnGen Cas9 NLS; New England Biolabs, M0646T) were co-injected into zebrafish embryos at the one-cell stage. A dozen of injected embryos were subjected to DNA extraction and genotyping at 24 hpf. The rest of founders (F0) were raised to adulthood and the individuals carrying mutations were identified by genotyping on caudal fin with sequencing. The F0 founders bearing mosaic mutations at the target sites were then outcrossed with WT fish to produce F1 heterozygotes. The F1 heterozygotes harboring same frame-shift mutation were incrossed to generate F2 homozygous mutants.
4
Generating gp9 Mutant Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We generated gp9SMU15 mutants using the CRISPR/Cas9 method. The zebrafish gp9 target within exon 2 is 5’-GGGCAAAGTCACGCACCTGC-3’. gp9 guide RNA was transcribed in vitro by using mMESSAGE mMACHINE kit (Ambion). We generated gp9 mutants by injecting one-cell stage embryos with Cas9 protein (EnGen Cas9 NLS, NEB) and gRNA. F0 fish were crossed with wild-type (WT) fish to produce F1 progeny, which were then genotyped and sequenced to identify the inheritable mutation. We acquired the main frameshift mutations with the deletion of 17 bp (F1). We crossed the heterozygotes F1 gp9SMU15/+ to generate homozygous mutant F2 gp9SMU15. All work involving zebrafish was reviewed and approved by the Animal Ethics Committee or the Animal Research Advisory Committee of Southern Medical University and South China University of Technology
5
Optimized CRISPR Cas9 Injection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The concentration of SpCas9 injected was about 800 ng/μl SpCas9 (final concentration) and about 300 ng/μl of sgRNA (IVT; final concentration after purification). This corresponds roughly to a 1:2 ratio (SpCas9: sgRNA-3). SpCas9 has about 5× the molecular weight of the sgRNA.
The injection mix is prepared as follows (total volume of 10 μl): add sgRNA, ddH2O, and 10× incubation buffer NEB and mix thoroughly. Gently add the SpCas9 and mix again thoroughly by pipetting up and down. It is mandatory to add SpCas9 as the last ingredient because low salt concentrations may cause SpCas9 to precipitate (40 (link)).
X μl sgRNA (IVT; to a final concentration of 320 ng/μl; corresponds to 1:2 ratio SpCas9: sgRNA).
1 μl 10× NEB incubation buffer.
Y μl ddH2O (RNase free) to a total of 10 μl (X + Y = 6.5 μl).
2.5 μl SpCas9 (EnGen Cas9 NLS, NEB #M0646T; 3.22 μg; final concentration 0.8 μg/μl).
Mix gently and incubate the mix at 37°C for 2 min.
Load the mix onto a column (Ultrafree-MC-HV 0.45 μm [Ref: UFC30HV00]).
Spin for 1 min in a table-top centrifuge @14,000g.
Reincubate the flow-through at 37°C for 2 min.
Let the mix equilibrate at RT for ∼30 min before injection. Never put the mix back on ice.
The injection mix is prepared as follows (total volume of 10 μl): add sgRNA, ddH2O, and 10× incubation buffer NEB and mix thoroughly. Gently add the SpCas9 and mix again thoroughly by pipetting up and down. It is mandatory to add SpCas9 as the last ingredient because low salt concentrations may cause SpCas9 to precipitate (40 (link)).
X μl sgRNA (IVT; to a final concentration of 320 ng/μl; corresponds to 1:2 ratio SpCas9: sgRNA).
1 μl 10× NEB incubation buffer.
Y μl ddH2O (RNase free) to a total of 10 μl (X + Y = 6.5 μl).
2.5 μl SpCas9 (EnGen Cas9 NLS, NEB #M0646T; 3.22 μg; final concentration 0.8 μg/μl).
Mix gently and incubate the mix at 37°C for 2 min.
Load the mix onto a column (Ultrafree-MC-HV 0.45 μm [Ref: UFC30HV00]).
Spin for 1 min in a table-top centrifuge @14,000g.
Reincubate the flow-through at 37°C for 2 min.
Let the mix equilibrate at RT for ∼30 min before injection. Never put the mix back on ice.
6
Generation of SLC25A11 Knockout Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Generation of SLC25A11 knockout mouse: Mixture of Cas9 protein (100 ng/ul) and gRNA (50 ng/ul) was injected in the cytoplasm of pronuclei. sgRNA sequences, 5’-ACTGCATCCGGTTCTTCACC-3′,5’-CGGATGCAGTTGAGTGGTGA-3′. Indel mutations in F1 mice were identified after TA cloning and sequencing. Cas9 protein (EnGen Cas9 NLS) was purchased from NEB (Ipswich, MA, USA). sgRNAs were generated using T7 in vitro transcription kit (NEB, Ipswich, MA, USA).
This study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute (NCCRI; protocols: NCC-18-429), which is an Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International) accredited facility that abides by the Institute of Laboratory Animal Resources guide. All animal experiments were performed in accordance with the guidelines for the Care and Use of Laboratory Animals of the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute.
This study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute (NCCRI; protocols: NCC-18-429), which is an Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International) accredited facility that abides by the Institute of Laboratory Animal Resources guide. All animal experiments were performed in accordance with the guidelines for the Care and Use of Laboratory Animals of the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute.
7
Generation of Cdh11-EGFP Knock-in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cdh11-crRNA (5′-GUCAUCAUCAAAAGUGUCUUguuuuagagcuaugcuguuuug-3′) and tracrRNA (5′- AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3′) were chemically synthesized by FASMAC (Kanagawa, Japan). Recombinant Cas9 protein (EnGen Cas9 NLS) were purchased from NEB. The long single-strand DNA (long ssDNA) donor containing EGFP sequence flanked by 345 nucleotides (nt) left homology arm and 410 nt right homology arm was synthesized by using Guide-it Long ssDNA Strandase Kit (Takara Bio). The guide RNAs, Cas9 proteins, and the donor ssDNA were microinjected into B6C3F1 mouse zygotes. An obtained knock-in founder was confirmed to carry the correct EGFP-fused allele by PCR and sequencing analyses, and the subsequent generations were used in this study.
8
CRISPR-Cas9 for prmt5 Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The guide RNA (gRNA) was designed using CHOPCHOP CRISPR Design website [59 (link)]. The designed oligos were annealed and ligated into pDR274 after digestion of the plasmid with BsaI (NEB). The gRNA was prepared in vitro using the MEGAshortscript T7 transcription kit (Ambion) after linearizing the plasmid with DraI (NEB) [60 (link)] before being purified using illustra MicroSpin G-50 Columns (GE Healthcare). 1 nL of a solution containing 10μM EnGen Cas9 NLS (NEB) and 100 ng/μl of gRNA was injected at the one-cell stage. WT, heterozygous, and homozygous prmt5 animals were identified by PCR. Oligonucleotide sequences are listed in S2 Table .
9
Sema3A/Sema3F Knockout in Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cocktail of three sgRNAs (500 pg each) targeting Sema3A or Sema3F were co-injected together with 36 ng of either EnGen® Cas9-NLS (NEB #MO646M) or Cas9-Dead-NLS (Genaxxon Bioscience) proteins, 0.1 M KCl and fluorescein dye.
All embryos were then analysed by in situ hybridisation or used for grafting experiments. We did not keep some embryos to assess the occurrence of genomic modifications.
All embryos were then analysed by in situ hybridisation or used for grafting experiments. We did not keep some embryos to assess the occurrence of genomic modifications.
10
CRISPR-SaCas9 Mediated 5-HT1A Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the pathogenic role of central 5-HT overactivation, we conducted a 5-HT1A receptor gene (Htr1a) knockdown model using the clustered regularly interspaced short palindromic repeats (CRISPR)-SaCas9 system. Briefly, the pX601-AAV-CMV-SaCas9-hU6-single guide (sg) RNA plasmid was used (Additional file 1 : Fig. S7A), and gRNA candidates for Htr1a and sham were selected using a CRISPR design tool (crispor.tefor.net). A mixture of Cas9 protein (100 ng/mL, EnGen Cas9 NLS; purchased from NEB) and gRNA (50 ng/mL) was injected into the perinuclear cytoplasm. The sgRNAs were generated with a MEGAshotscript T7 kit (Invitrogen, Carlsbad, CA, USA) using the sgRNA sequences listed in Additional file 1 : Table S1. After exchanging the CMV for the human synapsin (hSyn) promoter, the sgRNAs were validated in two cell lines (Hepa1c1c7 hepatoma and Neuro2A neuroblastoma) using Lipofectamine 3000 reagents (Thermo, Waltham, MA, USA), as shown in Additional file 1 : Fig. S7B to D. To titrate recombinant AAV vector particles, the plasmid vectors and packaging vector were co-transfected into AAV-293 cells using jetPEI (Polyplus-transfection, USA). At 3 days post-transfection, the virus was purified by ultracentrifugation with a CsCl density gradient, followed by quantification of virus titers using qPCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!