To determine virus titers as focus-forming units (FFU) and foci sizes, Vero E6 cells grown in 12-well plates were infected with 100 μl of serial 10-fold dilutions of virus. To determine virus titers in the lung, 50 mg lung tissue was first homogenized with a bead mill (Analytic Jena) and the homogenate was serially diluted. After 2 h of incubation the viral inoculum was removed and cells were overlaid with MEM containing 0.6% microcrystalline cellulose Avicel (FMC BioPolymer). Forty-eight hours after infection cells were fixed with 4% formalin, permeabilized with 0.1% Triton X-100, and blocked with 3% BSA in PBS. Cells were then incubated with a monoclonal mouse anti-SARS-CoV-2 nucleocapsid antibody (provided by Sven Reiche, Friedrich Loeffler Institute, Riems, Germany) for 1 h, and then with goat anti-mouse IgG-Alexa Fluor 568 secondary antibody (Invitrogen) for 45 min. To determine the cell-to-cell spread of mutant viruses in cells, images of 30 randomly selected foci of infected cells were taken at 50-fold magnification using an inverted fluorescence microscope (Axiovert S100, Zeiss). The foci areas were measured using ImageJ software (Schneider et al., 2012 (link)), from which the diameters were calculated.
Bead mill
Manufactured by Analytik Jena
Sourced in Germany
The Bead mill is a laboratory equipment designed for efficient cell disruption and homogenization of various sample materials. It utilizes a combination of mechanical force and high-speed agitation to break down cellular structures and release intracellular contents.
Automatically generated - may contain errors
Lab products found in correlation
Avicel, by FMC Biopolymer (2 mentions)
Axiovert s100, by Zeiss (2 mentions)
Neb luna universal probe one step rt qpcr kit, by New England Biolabs (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Innuprep virus rna kit, by Analytik Jena (2 mentions)
Goat antimouse igg alexa fluor 568 secondary antibody, by Thermo Fisher Scientific (1 mentions)
Innuprep virus dna rna kit, by Analytik Jena (1 mentions)
Qtower g3 cycler, by Analytik Jena (1 mentions)
Luna universal probe one step rt qpcr kit, by New England Biolabs (1 mentions)
Biowhittaker, by Lonza (1 mentions)
Alexa fluor 488 goat anti rabbit igg secondary antibody, by Thermo Fisher Scientific (1 mentions)
Carboxymethylcellulose sodium, by Merck Group (1 mentions)
6 protocols using bead mill
1
Quantifying SARS-CoV-2 Virus Titers and Spread
2
SARS-CoV-2 RNA Detection in Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To extract RNA from lung tissue, 25 mg of lung tissue was first homogenized in a bead mill (Analytic Jena). RNA was isolated from oral swabs, oropharyngeal swabs, and the homogenized lung tissue using the innuPREP Virus DNA/RNA Kit (Analytik Jena, Jena, Germany). Total SARS-CoV-2 RNA was quantified by quantitative reverse transcription PCR (RT-qPCR), employing the forward primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT), the reverse primer E_Sarbeco_R2 (ATATTGCAGCAGTACGCACACA), and the probe E_Sarbeco_P1 (FAM-ACACTAGCCATCCTTACTGCGCTTCG/ZEN/-IBFQ), which targeted the E gene region of SARS-CoV-245 . Subgenomic SARS-CoV-2 RNA transcripts were quantified using the same assay, except that the forward primer was substituted with the primer sgLeadSARSCoV2 (CGATCTCTTGTAGATCTGTTCTC), which targeted the leader sequence of the SARS-CoV-216 (link). The assay was performed on a qTower G3 cycler (Analytik Jena) using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) and the following cycling conditions: 10 min at 55 °C for reverse transcription, 3 min at 94 °C for activation of the polymerase and 40 cycles of 15 s at 94 °C and 30 s at 58 °C.
3
SARS-CoV-2 Viral Titer and RNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine virus titers from 50 mg of lung tissue, tissue homogenates were prepared using a bead mill (Analytic Jena) and 10-fold serial dilutions were prepared in MEM, which were then added to Vero E6 cells in 12-well plates. The dilutions were removed after 2 hours and cells were overlaid with 1.25% microcrystalline cellulose (Avicel) in MEM supplemented with 10% FBS and penicillin/streptomycin. Two days later, cells were formalin fixed, stained with crystal violet, and plaques were counted. RNA was extracted from 25 mg of lung homogenates and oropharyngeal swabs using the innuPREP Virus RNA kit (Analytic Jena). Viral RNA copies were quantified in 10% of the obtained eluate volume with a 1-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe [69 (link)] on a StepOnePlus RealTime PCR System (Thermo Fisher Scientific).
4
Quantifying SARS-CoV-2 Titers in Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The number of replication-competent virus particles was determined in 50 mg of lung tissue. For quantification, lung samples were homogenized in a bead mill (Analytik Jena), serially diluted in MEM, and plated on 12-well plates containing confluent Vero E6 cells. After 2.5 h at 37 °C and 5% CO2, the inoculum was removed, and cells were overlaid with Eagle’s Minimum Essential Medium (EMEM; Lonza™ BioWhittaker™) medium containing 1.5% microcrystalline cellulose and carboxymethyl cellulose sodium (Vivapur 611p; JRS Pharma). Seventy-two hours after infection the plates were fixed with 4% PBS-buffered formaldehyde.
To conduct indirect immunofluorescence staining, the cells were permeabilized with 0.1% Triton X-100 and blocked for 30 min with 3% BSA diluted in PBS. After washing the plates with PBS, the primary polyclonal anti-SARS Coronavirus nucleocapsid antibody (Invitrogen) was added for 1 h followed by the goat-anti-rabbit IgG-AlexaFluor 488 secondary antibody (Invitrogen) for 45 min. To determine the titers, the plaques were counted using an inverted fluorescence microscope (Axiovert S100, Zeiss).
To conduct indirect immunofluorescence staining, the cells were permeabilized with 0.1% Triton X-100 and blocked for 30 min with 3% BSA diluted in PBS. After washing the plates with PBS, the primary polyclonal anti-SARS Coronavirus nucleocapsid antibody (Invitrogen) was added for 1 h followed by the goat-anti-rabbit IgG-AlexaFluor 488 secondary antibody (Invitrogen) for 45 min. To determine the titers, the plaques were counted using an inverted fluorescence microscope (Axiovert S100, Zeiss).
5
SARS-CoV-2 Virus Titer Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine virus titers from 50 mg of lung tissue, tissue homogenates were prepared using a bead mill (Analytik Jena, Jena, Germany), and 10-fold serial dilutions were prepared in MEM, which were then added to Vero E6 cells in 12-well plates. The dilutions were removed after 2 h and cells were overlaid with 1.25% microcrystalline cellulose (Avicel, FMC BioPolymer, Hamburg, Germany) in MEM supplemented with 10% FBS and penicillin/streptomycin. Three days later, cells were formalin-fixed, stained with crystal violet and plaques were counted. RNA was extracted from 25 mg of lung homogenates and oropharyngeal swabs using the innuPREP Virus RNA kit (Analytik Jena, Jena, Germany). Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the NEB Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs, Ipswich, MA, USA) and previously published TaqMan primers and probe (SARS-CoV-2 E_Sarbeco) [20 (link)] on a StepOnePlus RealTime PCR System (Thermo Fisher Scientific, Waltham, MA, USA).
6
Quantifying Replication-Competent Virus in Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of replication-competent virus, 50 mg of lung tissue were used. Serial 10-fold dilutions were prepared after homogenizing the organ samples in a bead mill (Analytic Jena). The dilutions were plated on Vero E6 cells grown in 24-well plates and incubated for 2.5 h at 37 °C. Subsequently, cells were overlaid with MEM containing 1.5% carboxymethylcellulose sodium (Sigma Aldrich) and fixed with 4% formaldehyde solution 72 h after infection. To count the plaque-forming units, plates were stained with 0.75% methylene blue.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!