The largest database of trusted experimental protocols

4 protocols using mcf10a cdh1

1

Cell Line Maintenance and Validation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small-molecule inhibitors were obtained from SelleckChem. siRNAs were obtained from GE Dharmacon. Cell lines were obtained from American Type Culture Collection (ATCC) and European Collection of Cell Cultures (ECACC) in 2010-2011 and maintained according to the supplier’s instructions as described in (19 (link),47 (link)). The MCF10A CDH1-/- and MCF10A CDH1+/+ isogenic cell lines, were obtained in 2014 from Sigma Aldrich, and maintained according to the supplier’s instructions. At sixth-monthly intervals and prior to storage, the identity of each cell line was confirmed by short tandem repeat (STR) profiling of 10 loci using the GenePrint 10 system (Promega). At monthly intervals, mycoplasma testing of cell cultures was carried out using MycoAlert Mycoplasma Detection Kit (Lonza).
+ Open protocol
+ Expand
2

Isogenic MCF10A and NCI-N87 Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF10A cells (CRL 10317), a non-tumorigenic mammary epithelial cell line, and the derived isogenic line with CDH1 knockout (MCF10A-CDH1−/−) were purchased from Sigma (#CLLS1042). The MCF10A isogenic lines were cultured in DMEM/F12: (1:1) (Invitrogen, Carlsbad, CA, USA) with 5% horse serum (Invitrogen), 10 μg/mL Actrapid neutral insulin (Novo Nordisk Pharmaceuticals Ltd. Bagsværd, Denmark), 20 ng/mL human epidermal growth factor (Peprotech, Rehovot, Israel), 100 ng/mL cholera toxin, and 500 ng/mL hydrocortisone (Sigma Aldrich, St Louis, MO, USA). NCI-N87 gastric cancer cells (CRL-5822) were purchased from ATCC and CDH1 knockouts were generated via Crispr-Cas9 (manuscript in preparation). Briefly, the NCI-N87-CDH1−/− cell line was generated using the following CRISPR guide RNA sequence: 5′ GCTTCATTCACATCCAGCACATCCACGGTGAC 3′ which targeted exon 10 of the CDH1 gene. This gave rise to a single nucleotide frameshift deletion followed by a T/A SNP in the CDH1 gene, which was confirmed by Sanger sequencing. The NCI-N87 isogenic lines were cultured in DMEM/F12 (1:1) (Invitrogen) with 10% fetal bovine serum (Invitrogen). All cells were grown at 37 °C with 5% CO2.
+ Open protocol
+ Expand
3

Isogenic Cell Line Generation and Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF10A cells (product no: CRL 10317), a non tumorigenic mammary epithelial cell line, and the derived isogenic line with CDH1 knock out (MCF10A CDH1-/-) using CompoZr ZFN technology (product no: CLLS1042) were purchased from Sigma. The MCF10A isogenic lines were cultured in DMEM/F12: (1:1) (Invitrogen) with 5% horse serum (Invitrogen), 10 μg/ml Actrapid Penfil neutral insulin (Novo Nordisk Pharmaceuticals Ltd), 20 ng/ml human epidermal growth factor (Peprotech), 100 ng/ml cholera toxin, and 500 ng/ml hydrocortisone (Sigma) [21 (link)]. Cells were grown at 37°C with 5% CO2, seeded into T75 flasks at densities of 3.0 × 105 and 4.5 × 105, respectively and passaged at 90% confluency (~3 days) for a maximum of ten passages (http://brugge.med.harvard.edu/protocols).
+ Open protocol
+ Expand
4

Isogenic MCF10A Cell Line Comparison

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF10A and the derived CDH1-negative isogenic line (MCF10A CDH1 -/-) were purchased from Sigma-Aldrich (St. Louis, MO). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM)/F12 (1:1; Life Technologies, Carlsbad, CA) with 5% horse serum (Life Technologies), 10 µg/ml insulin (Novo Nordisk Pharmaceuticals Ltd, Bagsvaerd, Denmark), 20 ng/ml human epidermal growth factor (Peprotech, Rocky Hill, NJ), 100 ng/ml cholera toxin (Sigma-Aldrich), and 500 ng/ml hydrocortisone (Sigma-Aldrich). 7 The cells were cultured in exponential growth phase at 37 °C and 5% CO 2 . 7, 8 An isogenic MCF10A cell line pair was selected to demonstrate drug-induced synthetic lethal phenotypes against CDH1 in a nonmalignant cell background.
Vorinostat was purchased from SelleckChem (Houston, TX), and paclitaxel (Taxol) was purchased from Sigma-Aldrich. Both drugs were reconstituted in 100% DMSO, stored at -80 °C, and individual aliquots were diluted to working stocks in complete growth medium prior to use in an experiment. Vorinostat, a histone deacetylase inhibitor, was selected because it has previously demonstrated selective lethality toward CDH1-deficient MCF10A cells. 9 Taxol was chosen as a chemotherapeutic agent that demonstrated nondiscriminate lethality in the MCF10A isogenic cell line pair.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!