Log In Sign up
The largest database of trusted experimental protocols

Dcas vp64 blast

Manufactured by Addgene
Visit Supplier

DCAS-VP64_Blast is a plasmid available from Addgene. It is designed for CRISPR activation experiments.

Automatically generated - may contain errors

Lab products found in correlation

Ms2 p65 hsf1 hygro, by Addgene (4 mentions) Lentiv spcas9 puro, by Addgene (2 mentions) Lrg2.1 backbone, by Addgene (2 mentions) Ms2 sgrna zeo, by Addgene (2 mentions) Krab dcas9 p2a mcherry, by Addgene (1 mentions) Plentirnaguide 002 hu6 rfxcas13d dr bsmbi efs puro wpre, by Addgene (1 mentions) Mruby2 n1, by Addgene (1 mentions) Lenti sgrna ms2 zeo, by Addgene (1 mentions)

Spelling variants of this product

Lenti dCAS-VP64_Blast (11 citations)

8 protocols using dcas vp64 blast

1

Functional Screening of lncRNAs Using CRISPRi/a

Check if the same lab product or an alternative is used in the 5 most similar protocols
For CRISPRi, the KRAB-dCas9-P2A-mCherry (Addgene # 60954) plasmid was delivered into Huh7.5 cells through lentivirus infection. And the mCherry-positive cells were enriched by FACS 3 days after infection. Then the sgRNAs targeting the negatively selected lncRNAs were delivered into cells with stable expressing of dCas9-KRAB by lentivirus infection followed by cell proliferation assay and cell lethality assay. For CRISPRa, the three plasmids dCAS-VP64_Blast (Addgene # 61425), MS2-P65-HSF1_Hygro (Addgene # 61426) and sgRNAs carrying EGFP for each positively selected lncRNAs were delivered into cells through transient transfection. Then the EGFP-positive cells were enriched by FACS 3 days after transfection followed by cell lethality assay.
Zhu S., Li W., Liu J., Chen C.H., Liao Q., Xu P., Xu H., Xiao T., Cao Z., Peng J., Yuan P., Brown M., Liu X.S, & Wei W. (2016). Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR library. Nature biotechnology, 34(12), 1279-1286.
+ Open protocol
+ Expand
2

Cas13d-mediated RNA Degradation in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to conduct the Cas13d-mediated RNA degradation, we generated stable cell line by infecting them with lentivirus expressing Dox-inducible Cas13d (TetO-NLS-RfxCas13d-NLS-WPRE-EFS-rtTA3–2A-Blast, Addgene #138149) and appropriate gRNA cloned in to a Cas13d gRNA backbone (pLentiRNAGuide_002-hU6-RfxCas13d-DR-BsmBI-EFS-Puro-WPRE, Addgene #138151), as previously described. gRNA sequence was designed by a algorithm described previously (Wessels et al., 2020 ), and primer sequences for cloning gRNA into the lentiviral backbone (Addgene #138151) for TFF1e-gRNA are the following (5’ to 3’), forward: AAACGACTGTTGCAACAAACGACCCCA, reverse: AAAATGGGGTCGTTTGTTGCAACAGTC. Cells were treated with 2μg/ml doxycycline in the culturing medium for four to seven days before harvest. To generate enzymatically dead CasRx fused with FTO and HA-tag (dCasRx-FTO-HA) expressing stable cell line, we generated a pLenti-dCasRx-FTO-HA-Blast based on the backbone of dCAS-VP64_Blast (Addgene #61425). In the dCasRX-FTO-HA expressing MCF7 stable cell line, TFF1e-gRNA for the CasRx system was introduced using lentiviral infection.
Lee J.H., Wang R., Xiong F., Krakowiak J., Liao Z., Nguyen P.T., Moroz-Omori E.V., Shao J., Zhu X., Bolt M.J., Wu H., Singh P.K., Bi M., Shi C.J., Jamal N., Li G., Mistry R., Jung S.Y., Tsai K.L., Ferreon J.C., Stossi F., Caflisch A., Liu Z., Mancini M.A, & Li W. (2021). Enhancer RNA m6A Methylation Facilitates Transcriptional Condensate Formation and Gene Activation. Molecular cell, 81(16), 3368-3385.e9.
+ Open protocol
+ Expand
3

Generation of Plasmid Constructs for Cell Studies

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
eGFP-TDP-43 (WT & ΔNLS) and optoTDP43 constructs were previously generated by our lab98 (link). Other plasmid constructs were generated by Gibson Assembly. NUP62 (Gift from Akiko Takedo) and mRuby (from Addgene Plasmid# 54614) fragments were PCR-amplified. The fragments were then inserted at NotI and NheI (mRuby-NUP62) or BamHI (NUP62-mRuby) restriction enzyme sites of the mRuby2-N1 base vector (Addgene Plasmid# 54614). FLAG-DPR50-eGFP and FLAG-DPR50-mCherry were gifts from Davide Trotti. Lentiviral GR50 was created by PCR amplifying FLAG-GR50-eGFP and inserting fragment into BsrGI and BsiWI restriction enzyme sites of lenti dCAS-VP64_Blast (Addgene Plasmid # 61425) base vector. Primers are provided in Supplementary Table 5. Newly generated plasmids were validated by Sanger Sequencing (Genewiz).
Gleixner A.M., Verdone B.M., Otte C.G., Anderson E.N., Ramesh N., Shapiro O.R., Gale J.R., Mauna J.C., Mann J.R., Copley K.E., Daley E.L., Ortega J.A., Cicardi M.E., Kiskinis E., Kofler J., Pandey U.B., Trotti D, & Donnelly C.J. (2022). NUP62 localizes to ALS/FTLD pathological assemblies and contributes to TDP-43 insolubility. Nature Communications, 13, 3380.
+ Open protocol
+ Expand
4

CRISPR-Cas9 Knockout Protocols for Single and Double Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Single knockouts were generated either using a two-vector Streptococcus pyogenes (Sp) Cas9 system: LentiV_SpCas9_puro (Addgene, 108100) and LRG2.1 backbone (Addgene, 108098) or an all-in-one (expressing both SaCas9 and sgRNA) single vector Staphylococcus aureus (Sa) Cas9 system. The SaCas9 all-in-one vector, henceforth referred to as SaLgC, was derived by cloning the SaCas9 coding sequence (dCAS-VP64_Blast, Addgene: 61425) and its associated sgRNA expression cassette into a lentiviral vector. For double knockout experiments, ALC1 was knocked out using the single vector SaCas9 system and the two-vector SpCas9 system was employed for the depletion of the second protein of interest. Plasmids generated in this study, which will available through Addgene: (1) SaLgC (U6-sgRNA-EFS-SaCas9-P2A-GFP), (2) SaLgCp (U6-sgRNA-EFS-SaCas9-P2A-Puro) and (3) SaLgCn (U6-sgRNA-EFS-SaCas9-P2A-Neo). sgRNAs were designed to target the functional domain of protein and were cloned by annealing the two complementary DNA oligos into a BsmB1-digested vector using T4 DNA ligase. To improve U6 promoter transcription efficiency, an additional 5’ G nucleotide was added to all sgRNA oligos that did not already start with a 5’ G. List of sgRNAs used in the study are listed in Supplementary Table 4.
Verma P., Zhou Y., Cao Z., Deraska P.V., Deb M., Arai E., Li W., Shao Y., Puentes L., Li Y., Patankar S., Mach R.H., Faryabi R.B., Shi J, & Greenberg R.A. (2021). ALC1 links chromatin accessibility to PARP inhibitor response in homologous recombination-deficient cells. Nature cell biology, 23(2), 160-171.
+ Open protocol
+ Expand
5

Defining HNF1A-Dependent Islet Gene Set

Check if the same lab product or an alternative is used in the 5 most similar protocols
To define a high-confidence islet HNF1A-dependent gene set, we intersected: (1) 115 downregulated genes from Hnf1a−/− islets22 (link); and (2) 570 genes that showed increased expression (adjusted P ≤ 0.05 and mean normalized expression > 500) after CRISPR–SAM activation of Hnf1a in MIN6 mouse β cells. This MIN6-SAM cell line was generated by successive transduction of MIN6 cells with lentivirus dCAS-VP64_Blast (61425; Addgene), followed by blasticidin selection (1 µg ml−1) and lentivirus MS2-P65-HSF1_Hygro (61426; Addgene), followed by hygromycin selection (100 µg ml−1). MIN6-SAM cells were subsequently transduced with sgRNA expressing vector lenti sgRNA-(MS2)-zeo (61427; Addgene). RNAs from triplicates of two independent Hnf1a-activating sgRNAs and two independent control sgRNAs were used for RNA-seq. In total, 21 genes showed concordant downregulation and upregulation in both models (Supplementary Table 9).
Beucher A., Miguel-Escalada I., Balboa D., De Vas M.G., Maestro M.A., Garcia-Hurtado J., Bernal A., Gonzalez-Franco R., Vargiu P., Heyn H., Ravassard P., Ortega S, & Ferrer J. (2022). The HASTER lncRNA promoter is a cis-acting transcriptional stabilizer of HNF1A. Nature Cell Biology, 24(10), 1528-1540.
+ Open protocol
+ Expand
6

CRISPR-Cas9 Knockout Protocols for Single and Double Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Single knockouts were generated either using a two-vector Streptococcus pyogenes (Sp) Cas9 system: LentiV_SpCas9_puro (Addgene, 108100) and LRG2.1 backbone (Addgene, 108098) or an all-in-one (expressing both SaCas9 and sgRNA) single vector Staphylococcus aureus (Sa) Cas9 system. The SaCas9 all-in-one vector, henceforth referred to as SaLgC, was derived by cloning the SaCas9 coding sequence (dCAS-VP64_Blast, Addgene: 61425) and its associated sgRNA expression cassette into a lentiviral vector. For double knockout experiments, ALC1 was knocked out using the single vector SaCas9 system and the two-vector SpCas9 system was employed for the depletion of the second protein of interest. Plasmids generated in this study, which will available through Addgene: (1) SaLgC (U6-sgRNA-EFS-SaCas9-P2A-GFP), (2) SaLgCp (U6-sgRNA-EFS-SaCas9-P2A-Puro) and (3) SaLgCn (U6-sgRNA-EFS-SaCas9-P2A-Neo). sgRNAs were designed to target the functional domain of protein and were cloned by annealing the two complementary DNA oligos into a BsmB1-digested vector using T4 DNA ligase. To improve U6 promoter transcription efficiency, an additional 5’ G nucleotide was added to all sgRNA oligos that did not already start with a 5’ G. List of sgRNAs used in the study are listed in Supplementary Table 4.
Verma P., Zhou Y., Cao Z., Deraska P.V., Deb M., Arai E., Li W., Shao Y., Puentes L., Li Y., Patankar S., Mach R.H., Faryabi R.B., Shi J, & Greenberg R.A. (2021). ALC1 links chromatin accessibility to PARP inhibitor response in homologous recombination-deficient cells. Nature cell biology, 23(2), 160-171.
+ Open protocol
+ Expand
7

CRISPR-Mediated Activation of MERVL Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
CRISPR activation of MERVL expression was achieved by the Synergistic Activation Mediator (SAM)23 (link) using the three-vector system: dCAS-VP64-Blast (Addgene #61425), MS2-P65-HSF1-Hygro (Addgene #61426) and MS2-sgRNA-Zeo (Addgene #61427), where the non-targeting or MERVL targeted (+317F4 from gag ATG) sgRNAs were cloned using BsmB1 restriction sites. Lentiviruses containing each of the plasmids were generated and ESCs were infected with a 1:1:1 mix of the viruses in presence of 8 μg/ml Polybrene. Infected cells were selected for 48 h with 10 μg/ml of Blasticidin, 250 μg/ml of Hygromycin, and 250 μg/ml Zeocin. Selected cells were collected for total RNA isolation and qPCR analysis.
Guallar D., Bi X., Pardavila J.A., Huang X., Saenz C., Shi X., Zhou H., Faiola F., Ding J., Haruehanroengra P., Yang F., Li D., Sanchez-Priego C., Saunders A., Pan F., Valdes V.J., Kelley K., Blanco M.G., Chen L., Wang H., Sheng J., Xu M., Fidalgo M., Shen X, & Wang J. (2018). RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells. Nature genetics, 50(3), 443-451.
+ Open protocol
+ Expand
8

CRISPR-Mediated Activation of MERVL Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
CRISPR activation of MERVL expression was achieved by the Synergistic Activation Mediator (SAM)23 (link) using the three-vector system: dCAS-VP64-Blast (Addgene #61425), MS2-P65-HSF1-Hygro (Addgene #61426) and MS2-sgRNA-Zeo (Addgene #61427), where the non-targeting or MERVL targeted (+317F4 from gag ATG) sgRNAs were cloned using BsmB1 restriction sites. Lentiviruses containing each of the plasmids were generated and ESCs were infected with a 1:1:1 mix of the viruses in presence of 8 μg/ml Polybrene. Infected cells were selected for 48 h with 10 μg/ml of Blasticidin, 250 μg/ml of Hygromycin, and 250 μg/ml Zeocin. Selected cells were collected for total RNA isolation and qPCR analysis.
Guallar D., Bi X., Pardavila J.A., Huang X., Saenz C., Shi X., Zhou H., Faiola F., Ding J., Haruehanroengra P., Yang F., Li D., Sanchez-Priego C., Saunders A., Pan F., Valdes V.J., Kelley K., Blanco M.G., Chen L., Wang H., Sheng J., Xu M., Fidalgo M., Shen X, & Wang J. (2018). RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells. Nature genetics, 50(3), 443-451.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!