Peltier thermocycler

The introgression lines of the BC₂F₅, along with the parental lines HA 89 and HA 458 (carrying Pl₁₇), were screened for resistance to downy mildew using the North America (NA) downy mildew race 734, a virulent race identified in USA in 2010 (Gulya et al., 2011 ). The whole seedling immersion method was used for the seedling tests as described by Gulya et al. (1991 ) and Qi et al. (2015 (link)). The susceptible plants showed an abundant white sporulation on the underside of the cotyledons and true leaves, while the resistant plants had no sporulation.
Simple sequence repeat (SSR) marker ORS963 and two single nucleotide polymorphism (SNP) markers, SFW04052 and SFW08268 that are linked to the Pl₁₇ downy mildew resistance gene were used to screen the introgression lines (Qi et al., 2015 (link)). Polymerase chain reaction (PCR) for SSR primers was performed on a Peltier thermocycler (Bio-Rad Lab, Hercules, CA, USA) with a touchdown program as described by Qi et al. (2011 (link)). Genotyping of the SNPs was performed using a newly developed technique of converting the SNPs into length polymorphism markers described by Qi et al. (2015 (link)). The PCR products were diluted 40–60 times and size segregated using an IR² 4300/4200 DNA Analyzer with denaturing polyacrylamide gel electrophoresis (LI-COR, Lincoln, NE, USA).

Non-phosphorylated oligodeoxynucleotides were purchased from IDT and full-length content was verified by separation of an aliquot on urea-containing 10% polyacrylamide gels followed by ultraviolet shadowing. Fully complementary strands were annealed at 200 μM strand concentration in buffer containing 20 mM Tris-HCl, pH 7.5, and 150 mM NaCl by first incubating at 95 °C for 90 s followed by slow cooling to 25 °C at a rate of 0.1 °C per second in a Peltier thermocycler (BioRad). Complete annealing was verified by electrophoresis using 2.5% low melting temperature agarose gel (Life Technologies, 15517-014) containing ethidium bromide and comparing the mobility with the single-stranded oligodeoxynucleotides. The sequences used for annealing can be found in Supplementary Table 5.

Sense (s) and antisense (as) 45-nt (s, 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; as, 5′-TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA-3′)^{32 (link)} and 100-nt oligonucleotides (s, 5′-ACATCTAGTACATGTCTAGTCAGTATCTAGTGATTATCTAGACATACATCTAGTACATGTCTAGTCAGTATCTAGTGATTATCTAGACATGGACTCATCC-3′; as, 5′-GGATGAGTCCATGTCTAGATAATCACTAGATACTGACTAGACATGTACTAGATGTATGTCTAGATAATCACTAGATACTGACTAGACATG TACTAGATGT-3′)^{27 (link)} were purchased at 1 µmol scale from IDT and dissolved in 150 mM NaCl, 1 mM dithiothreitol (DTT), 20 mM Tris-HCl, pH 7.5, annealing buffer to obtain a 1-mM single-stranded DNA stock solution. The quality of oligonucleotides was verified by denaturing polyacrylamide gel electrophoresis. Annealing of s and as strands was conducted by incubating 200 µM each of s and as strand in annealing buffer at 95 °C for 90 s followed by slow cooling to 25 °C at a rate of 0.1 °C s⁻¹ in a Peltier thermocycler (BioRad). The completion of annealing was verified by native agarose gel electrophoresis^{32 (link)}. A modified pUT7 plasmid corresponding to 3200-bp DNA was isolated from transformed Escherichia coli Top10 with a PureLink HiPure Plasmid Megaprep Kit (Invitrogen). The plasmid was linearized with HindIII (NEB) and further purified by standard ethanol precipitation method and resuspended in MilliQ water. Herring testes DNA (HT-DNA) was purchased from Sigma (catalog number: D6898).