Nanodrip 2000

The TRIzol^® reagent (AccuRef Scientific) was utilized to isolate RNA in accordance with the manufacturer's instructions. The RNA concentration was measured with the Nanodrip 2000 (Thermo Fisher Scientific, Inc.) and cDNA was synthesized using PrimeScript^® RT Master Mix Perfect Real-Time Reagent kit (Takara Bio, Inc.). Additionally, qRT-PCR was performed with cDNA and SYBR Green Reagent (Takara Biotechnology Co., Ltd.) on an ABI 7500 Real-Time PCR instrument (Applied Biosystems) as the following conditions: 95°C for 5 min, followed by 40 cycles of 95°C for 15 s, 58°C for 20 s and 72°C for 10 s. GAPDH (mRNA) or U6 (miRNA) served as the internal control. Relative quantification was calculated as 2^-ΔCt. ΔCt values = target gene mean Ct value - control gene mean Ct value. The primers involved in this study were shown as following: ALDH1A3 forward, TGAATGGCACGAATCCAAGAG and reverse, CACGTCGGGCTTATCTCCT; miR-320b forward, GCGAAAAAGCTGGGTTGAGA and reverse, AGTGCAGGGTCCGAGGTATT; GAPDH forward, GGAGCGAGATCCCTCCAAAAT and reverse GGCTGTTGTCATACTTCTCATGG; U6 forward, CTCGCTTCGGCAGCACA and reverse AACGCTTCACGAATTTGCGT.