Hotmastermix

Viral DNA was extracted with a standard phenol/chloroform (Sigma) extraction protocol. DNA is quantified with Nanodrop (Euroclone) and analyzed by PCR. We used HotMasterMix from Quantabio, following the instructions of the manufacturer. Primers were synthesized by the DNA LAB facility at the CEINGE-Biotecnologie Avanzate:
Forward oligonucleotide -5’AAAACACCACCCTCCTTACCT3’-
Reverse oligonucleotide -3’GCTCCGTTCAAATCCTCTTCG5’ -.
Their complementary regions are at both ends of the transgene.

Fecal microbiota samples were collected from duodenum, jejunum, ileum, cecum, and colon of 8-week old naive C56Bl/6 J mice after at least 1 week of acclimatization post mouse delivery. QIAamp Fast DNA Stool Mini Kit (Qiagen, cat#12855) was used DNA extracting. Amplicons spanning variable region 4 (V4) gene were generated with primers and barcodes (515 F, 806 R)^{52 (link)} using HotMaster Taq and HotMaster Mix (QuantaBio) and paired-end sequenced using Illumina MiSeq platform. The sequence was performed at the Harvard Medical School Biopolymer Facility. Established protocol for QIIME 2 software^{52 (link)} and LEfSe (Linear discriminant analysis Effect Size) version 1^{53 (link)} was used for data analysis. Sequences were quality filtered in which reads were truncated if two consecutive bases fall below a quality score of Q20 (1% error), and reads that were <75% of full length were discarded^{54 (link)}.