The largest database of trusted experimental protocols

Epitect bisulfite kit protocol

Manufactured by Qiagen
Sourced in Germany

The Epitect Bisulfite Kit Protocol is a laboratory equipment product designed for the conversion of DNA samples using bisulfite treatment. It enables the efficient conversion of unmethylated cytosine residues to uracil, while leaving methylated cytosine residues unchanged. This process is a crucial step in the analysis of DNA methylation patterns, which is an important epigenetic marker.

Automatically generated - may contain errors

3 protocols using epitect bisulfite kit protocol

1

Bisulfite-Based DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA extraction was performed using the TaKaRa Genomic DNA Extraction Kit (TaKaRa Co., Dalian, China). Genomic DNA (2 ug per sample) was bisulfite modified with the Epitect Bisulfite Kit Protocol (Qiagen), and the modified DNA was amplified using the following primers: BSQ1 forward, 5′-gaaggatttcggttaatttgggg-3′, and reverse, 5′-caaactcgccaaataactacctacg-3′; and BSQ3 forward, 5′-ggttgattatttgaggttaggtgtt-3′, and reverse, 5′-aaaacaattttcaaccaaccatc-3′. The modified DNA was amplified by PCR using 0.2 µM of each primer, 2 units of Hot Start Taq DNA polymerase, and 0.2 mM of each dNTP per reaction. Cycling programs were 95°C for 10 minutes, and then 40 cycles of 95°C for 30 seconds, 54°C for 30 seconds, and 72°C for 30 seconds, followed by a 5-minute incubation at 72°C. The PCR products were examined by gel electrophoresis in 1.5% agarose to confirm that a single band had been obtained and were then sequenced by Invitrogen. Methylation-specific PCR (MS-PCR) was carried out on bisulfate-treated DNA. The primers used were Un-methylated KLF4 forward, 5′-ggttgattatttgaggttaggtgttt-3′, and reverse, 5′-cccaaataacaaaaattacaaacat-3′; and Methylated KLF4 forward, 5′- gttgattatttgaggttaggtgttc-3′, and reverse, 5′-cgaataacgaaaattacaaacgta-3′. Umbilical cord blood DNA was used as a negative control, and it was methylated in vitro by using the Sss1 (CpG) methylase (New England Biolabs).
+ Open protocol
+ Expand
2

OLFM4 Promoter Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from HGC27, SGC-7901 and MGC-803 cells with the TaKaRa Genomic DNA Extraction Kit (TaKaRa Co., China). Genomic DNA (1 μg per sample) was modified with bisulfite using the Epitect Bisulfite Kit Protocol (Qiagen) following the manufacturer's instructions, and the modified DNA was amplified using the following primers: OLFM4 forward, AAAGGTGTGTGAAATGTTGAG, and reverse, CTCTCCCCCATTTTACT. The PCR products were gel extracted (Qiagen) to confirm that a single band had been obtained and were then sequenced by Invitrogen.
+ Open protocol
+ Expand
3

Bisulfite Sequencing of NKX6-2 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bisulfite sequencing was conducted as described [50 (link)]. Briefly, extracted DNA samples were bisulfite converted using the Epitect Bisulfite Kit Protocol (Qiagen, Düsseldorf, Germany). The sequencing service was provided by Tech Dragon Ltd., Hong Kong. The PCR primers were listed as follows: NKX6−2 forward: GGTTTGGAAAAGTTATTTG; NKX6−2 reverse: AAACTACACCTCAATAAAACC.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!