Infinite m1000 pro luminometer

Enzyme activity measurements were conducted using the UDP-Glo Glycosyltransferase assay kit (Promega) according to the kit manual. Prior to the experiment, B4GalT1 was dialyzed against a buffer containing 20 mM Tris-HCl and 150 mM KCl at pH 7.0. The reaction buffer used for the assay was 50 mM Bis-Tris, 5 mM MnCl₂ pH 6.3. For the assay, a standard amount of 80 ng of B4GalT1 was used, with UDP-galactose (Promega) and ovalbumin (Sigma-Aldrich) as the donor and the acceptor, respectively. The donor was serially diluted 11 times with the highest concentration being 4 mM, while the acceptor concentration was kept constant at 3 mM. Measurements were done in triplicate after 1-hour incubation at 37°C. The reaction was stopped by the addition of the UDP detection reagent. The luminescence values of the samples were measured with a Tecan Infinite M1000 Pro luminometer.

HEK293 cells cultured in 6-well plates (well diameter 34.8 mm) were transfected (Lipofectamine 3000, Thermo Fischer Scientific) with 500 ng of pcDNA3.1-HA-KLF4 FL or pcDNA3.1-N-DYK-PAX5, or pcDNA3.1-empty plasmids, 25 ng pRL-CMV and 500 ng of the firefly luciferase vector with KLF4 or PAX5 binding sites (described in section Plasmids). Using the Dual-Luciferase Reporter Assay System (Promega), after 24 h, cells were lysed and luciferase activity was measured using Tecan Infinite M1000 PRO luminometer. Relative reporter activity was calculated and normalized based on Renilla luciferase activity. All experiments were carried out in triplicate. Statistical evaluations were performed using Student’s t-test. P ≤ 0.05 was considered statistically significant.

TargetScan 5.2 (http://www.targetscan.org/) and PicTar (http://pictar.mdc-berlin.de/) in order to assess the complementarity of miR-99a to the FGFR3 3′-UTR. Luciferase reporter assays were performed in order to evaluate whether FGFR3 is a successful target for miR-99a. The cells were plated in a 12-well plate at ~90% confluence and transfected with 0.5 μg reporter plasmid, 40 nmol miR-99a mimics or their negative control by Lipofectamine 2000. The primers used for cloning FGFR3 mRNA 3′UTR were as follows: Forward, GGGCTCGAGGGCCACTGGTCCCCAACAATGTG, and reverse, GGGCGGCCGCCCAGTAACAGTACAGAACGA ACCAAC. Each sample was also cotransfected with 0.05 μg pRL-CMV plasmid expressing Renilla Luciferase (Promega, Manheim, Germany) as an internal control for the transfection efficiency. Subsequent to 48 h of transfection, the cells were harvested and lysed, and the luciferase reporter activities were measured using a luminometer (Tecan, Theale, UK). The firefly and Renilla Luciferase activities were measured with a Infinite^® M1000 PRO Luminometer (Tecan, Theale, UK). The firefly luciferase activity was normalized to the Renilla Luciferase activity for each transfected well. All the experiments were performed in triplicate.