Taqman master mix

In this experiment, we used GAPDH gene as an internal control for quantification of target genes expression. Two target genes (YBX2 and JHDM2A) and GAPDH (as internal control) were amplified with appropriate primers and probes (Table 2). All primers and probes were designed using gene runner software version 3.05 (Hastings SoftwareInc. Hastings, NY, USA). TaqMan real time PCR assay was carried out in final reaction volumes of 20 μl with 10 μl of a TaqManMaster Mix (Takara, Shiga, Japan), 0.2 μM of forward and reverse primers, and 2 μl of cDNA. Thermal cycling was performed using the ABI-7500 sequence detection system (Applied Biosystems, Foster, CA, USA) with the following cycling condition: 30 seconds at 95˚C as first denaturation step, followed by 40 cycles at 95˚C for 5 seconds and 60˚C for 34 seconds.

12 tumor and non-tumor pairs of colorectal tissues using for RNA with an RNA extraction kit (TAKARA, Dalian, China). RNA quality was analyzed using an Agilent Stratagene Bioanalyzer (Palo Alto, California, USA). The RNA integrity numbers (RINs) of all 24 samples indicated that the RNA quality was good, and the samples were then used for cDNA synthesis, after which they were stored at -20°C until further use. The amplification mixture (25 μl) contained 0.030 ng cDNA (3 μl), 1× TaqMan Master Mix, and 1× TaqMan Gene Expression Assay Primer/Probe Mix (TAKARA, Dalian, China). The thermal cycling parameters were as follows: 40 cycles at 95°C for 2 min, 95°C for 30 sec, 60°C for 30 sec, and 72°C for 30 s for pre-denaturation, denaturation, annealing and extension, respectively. The sequences of the primers used for PCR amplification designed according to GenBank mRNA sequences were TGTTCGTCATGGGTGTGAAC (forward) and ATGGCATGGACTGTGGTCAT (reverse).

Total RNA was extracted from fresh PBMCs using TriPure isolation reagent (Roche, Germany) according to the manufacturer’s instructions. Double-stranded cDNA was synthesized using the RevertAid TM first-strand cDNA synthesis kit (Fermentas, Germany). Following primers and probes were designed and used to determine the expression levels of STAT1, PSMB8, TAP1 : STAT1 (forward primer: 5ʹ-AACATGGAGGAGTCCACCAATG-3ʹ, reverse primer: 5ʹ-GATCACCACAACGGGCAGAG-3ʹ and TaqMan probe: FAM- TCTGGCGGCTGAATTTCGGCACCT -BHQ1), PSMB8 (forward primer: 5ʹ-GTTCAGATTGAGATGGCCCATG-3ʹ, reverse primer: 5ʹ-CGTTCTCCATTTCGCAGATAGTAC-3ʹ and TaqMan probe: FAM- CCACCACGCTCGCCTTCAAGTTCC -BHQ1), TAP1 (forward primer: 5ʹ-TACCGCCTTCGTTGTCAGTTATG-3ʹ, reverse primer: 5ʹ-GAGCCCAGGCAGCCTAGAAG-3ʹ and TaqMan probe: Fam-CGCACAGGGTTTCCAGAGCCGCC-BHQ1). The primers and probes of Tax and HBZ were synthesized according to published data [33 (link)]. The relative 2 standard curves real-time PCR was carried out on the cDNA samples using TaqMan master mix (Takara, Otsu, Japan) and a Q-6000 machine (Qiagen, Germany). The GAPDH gene was employed as a housekeeping gene to normalize the mRNA expression levels, and also to control the error between samples [32 (link), 34 (link)].