Oligo dt primer

For microRNA quantification, stem-loop reverse transcription followed by qPCR analysis was used. 500 ng total RNA was reverse transcribed using specific stem-loop primers (purchased from RiboBio Co., Ltd) and SYBR Green-based qPCR was carried out using specific forward primer and universal reverse primer (RiboBio Co., Ltd), U6 was used as an internal control. Primers for U6 are 5′CTCGCTTCGGCAGCACA 3′ (F), U6 5′AACGCTTCACGAATTTGCGT3′ (R). For mRNA qRT-PCR, 500 ng DNase I digested total RNA was reverse transcribed using oligo (dT) primer (TransGen Biotech) and gene specific primers were used for SYBR Green (Invitrogen) based qPCR. Primers for α-MHC are 5′CGACTACGCCTTCGTCTCTC-3′(F), 5′-AGCCCCATAAGGTAGGCAGA-3′ (R); for β-MHC: 5′GCATTCTCCTGCTGTTTCCTT-3′ (F) and 5′-TGGATTCTCAAACGTGTCTAGTGA-3′ (R); for GAPDH: 5′-TGCCCCCATGTTTGTGATG-3′(F), 5′-TGTGGTCATGAGCCCTTCC-3′(R). The average Ct for each triplicate from qRT-PCR was used for analysis. Fold change in microRNA (or mRNA) expression was calculated by ΔΔCt, normalized with ΔCt = AvgCtmicroRNA − AvgCtU6 (or GAPDH).

Quantitative RT-PCR was carried out using SYBR Premix Ex Taq Master Mix and a 2-Step kit (TaKaRa, Dalian, China). Total cellular RNA was isolated using TRIzol reagent according to the manufacturer’s instructions (Life Technologies). Total RNA (2.0 μg) was used for cDNA synthesis using oligo dT primers (Transgene, Beijing, China), and 1/10 of the cDNA volume was used for quantitative PCR. PCR amplification was carried out using a CFX96 Touch System (BioRad, Hercules, CA, USA). The PCR conditions were carried out according to the manufacturer’s instructions. The Ct values were normalized to that of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. The ΔΔCt method was used to determine the relative expression level of the target genes. All samples were run in triplicate in each experiment. Each assay was repeated three times. All primers were synthesized by TSINGKE (Beijing, China). The primers were as follows: for HCF-1, 5’ - GGC AGT GCT CTG ATT TCC A -3’ and 5’ - TTC AGG ATT GTT CCC GCT-3’; for CDC42, 5’ - GGA TTA TGA CAG ATT ACG ACC G-3' and 5’ - GTT ATC TCA GGC ACC CAC TTT-3’; and for GAPDH, 5’ - AAA TTG AGC CCG CAG CCT-3' and 5’ - CCC AAT ACG ACC AAA TCC GT-3’.

Validation of RNA-seq results was performed for 15 genes selected from DEGs that are involved in photosynthesis and other pathways using quantitative RT-PCR (qRT-PCR). The sequences of the gene primers are provided in Supplementary data S3. Total RNA was extracted as mentioned above for RNA-Seq and first-strand cDNA was synthesized using a TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit utilizing oligodT primers (TransGen Biotech, Beijing, China). qRT-PCR was carried out in the ABI Step One Plus Real-Time PCR System (Applied Biosystems, USA) utilizing the SYBR Premix Ex Taq RT-PCR kit (Takara Bio, Japan). qRT-PCR programs were as follows: (i) 95 °C for 30 s, (ii) 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 10s and extension at 72 °C for 10s. Rice ATP synthase subunit beta (OsAtpB, Os10g21266) gene was employed as negative controls in this study. The two rice reference gene Osactin1 (Os03g50885) and Osubiquitin (Os03g03920) were used as internal control genes for expression normalization.

Total RNA were extracted from the neuron monolayers and the tissue samples (50 mg tissue; n = 5/diet group) using TRIZOL (Invitrogen, China) following the instructions. 40 μL diethyl-pyrocarbonate-treated water was used to re-suspend the dried RNA. Oligo dT primers and TransScript Reverse Transcriptase were used to synthesize the first-stand cDNA (Beijing TransGen Biotech Co. Ltd., P.R. China) according to the instructions. The cDNA was diluted 10 times with sterile water and stored at −20°C before use.
Primers for the SPS1 genes (NM_001164084.1, Forward: 5′- CTGCTGGACTTATGCACAC -3′, Reverse: 5′- ACACCTCATTTCGCTGCT -3′, 108bp) and the β-actin (NM_205518.1, Forward: 5′- CCGCTCTATGAA GGCTACGC -3′
Reverse: 5′- CTCTCGGCTGTGGTGGTGAA -3′, 128 bp), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (K01458, Forward: 5′-AGAACATCATCCC AGCGT-3′
Reverse: 5′-AGCCTTCACTACCCTCTTG-3′, 182 bp) were designed using Primer Analysis Software (Oligo 7.24, Molecular Biology Insights, Inc. USA). qRT-PCR was used to determine mRNA quantities using a LightCycler^® 480 Real Time PCR System (Roche Applied Science, CA, USA) and GoTaq^® qPCR Master Mix (A6001, Promega, USA). Only one peak of the melting curve was shown for each PCR product. All data was normalized to the house keeping gene, GAPDH and β-actin. Pfaffl method was used to calculate relative changes on mRNA expression [55 (link)].