Pjet 1.2 clonejet pcr cloning kit

Healthy Asian seabass were euthanized with an overdose of Tricaine methane-sulfonate (MS-222) and the head kidney, gills and intestine were harvested and homogenized immediately in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) for RNA extraction. Total RNA was isolated in accordance with the manufacturer’s instructions. The concentrations of RNA were adjusted to 2 µg and reverse transcribed to cDNA using AMV Reverse Transcriptase according to the manufacturer’s instructions (Promega). IgT primers (Table S1) were designed based on IgT heavy chain conserved regions obtained through BLAST alignment of IgT amino acid sequences of Dicentrarchus labrax (Accession Number KM410929), Oncorhynchus mykiss (Accession number AY870263), Sparus aurata (Accession Number KX599200), Siniperca chuatsi (DQ16660) and Larimichthys crocea (Accession Number MW450786) retrieved from NCBI GenBank. The full-length cDNA sequence was amplified and ligated into pJET 1.2 CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, MA, USA). Following transformation into competent Escherichia coli (E. coli) XL1-Blue cells, positive clones were screened by ampicillin selection, colony PCR and sequenced.

Mouse CCL21 sequence was amplified from thymus cDNA by PCR with the following primers F1: CTGGCTAGCATGGCTCAGATGATGACTCTGAG, R1: GTCGGATCCTCTTGAGGG CTGTGTC and cloned into pJET1.2 (CloneJET PCR Cloning Kit, Thermo Fisher). The sequence was then cloned into the NheI + BamHI (both from NEB) digested ELC-Fc vector, a kind gift from Dr Timothy Springer (Addgene plasmid # 8636), replacing the original CCL19 sequence and fusing in-frame with a mutated version of human IgG1 Fc sequence (68 (link)). The recombinant fusion protein was produced in Expi293 cells (ThermoFisher) following the manufacturer's recommendations and purified using AktaPrime Plus (GE) with a HiTrap Protein A HP column (GE). The buffer was exchanged to phosphate buffer with a Vivaspin 20 column (molecular cutoff 10 kD), and the protein was frozen in 10% Glycerol and stored at –80˚C until used. Human CCL19 was purified in the same way as CCL21, but the original ELC-Fc vector was used. Human CXCL12 was purchased from Sinobiological. Recombinant mouse CCL21 was from BioLegend.

The epitope recognized by the highly neutralizing mAb 9G8 was mapped by characterization of escape mutants as described previously [11 (link)]. Briefly, SARS-CoV-2 at a MOI of 1 or 0.1 was incubated with different dilutions of mAb for 1 h at 37 °C. Next, the virus–mAb mixtures were incubated with Vero E6 cells in 24-well plates for 96 h at 37 °C. Virus replication was monitored, and the supernatant from the wells with evident viral replication was further passaged in the presence of mAb several times until a complete escape mutant was generated. The escape mutants were plaque purified for further characterization by sequencing, replication, and conducting VMN with mAb 9G8. The S gene was amplified and cloned into pJet 1.2 (CloneJET PCR cloning kit, Thermo Fisher Scientific, Waltham, MA, USA) for sequencing. The sequences of individual clones were analyzed by comparison with the sequences of the parent virus.