Total RNA was extracted using the
miRNeasy Micro Kit with on-column DNase digestion (217084, Qiagen), as described in the manufacturer’s instructions. cDNA was generated from 10 to 25 ng of total RNA using
Superscript III First Strand Synthesis Supermix (18080-400, Invitrogen); random hexamer primers were used for cDNA synthesis. A measure of 250 pg of cDNA were used as template for RT-qPCR in a 20-μl reaction containing 1 × PowerSybr Master Mix (ABI) and 1.25 μM Primers. Ct values were determined in triplicate on an ABI StepOnePlus instrument. Ct values were normalized to the expression of the housekeeping gene
ACTB, and ΔΔCt values were utilized in detecting CHD8 expression differences. Primers were designed using Primer3 plus. The primer sequences are:
CHD8 (exon 4–5) forward primer (5′- CTGCACAGTCACCTCGAGAA -3′)
CHD8 (exon 4–5) reverse primer (5′- TGGTTCTTGCACTGGTTCAG -3′)
CHD8 (exon 36–37) forward primer (5′- TGAACTGTTTGGGAATGGAA -3′)
CHD8 (exon 36–37) reverse primer (5′- TGCTGCTCTCTGGTGCAATA -3′)
ACTB forward primer (5′- GGCATCCTCACCCTGAAGTA -3′)
ACTB reverse primer (5′- AGCACTGTGTTGGCGTACAG -3′).
Cotney J., Muhle R.A., Sanders S.J., Liu L., Willsey A.J., Niu W., Liu W., Klei L., Lei J., Yin J., Reilly S.K., Tebbenkamp A.T., Bichsel C., Pletikos M., Sestan N., Roeder K., State M.W., Devlin B, & Noonan J.P. (2015). The autism-associated chromatin modifier CHD8 regulates other autism risk genes during human neurodevelopment. Nature Communications, 6, 6404.