The largest database of trusted experimental protocols

Mirneasy micro kit with on column dnase digestion

Manufactured by Qiagen

The MiRNeasy Micro Kit with on-column DNase digestion is a laboratory equipment product designed for the purification of total RNA, including small RNAs such as miRNA, from small amounts of various sample types. The kit utilizes a silica-membrane-based technology to efficiently capture and purify RNA, while the on-column DNase digestion step helps remove genomic DNA contamination.

Automatically generated - may contain errors

2 protocols using mirneasy micro kit with on column dnase digestion

1

Quantitative PCR of CHD8 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the miRNeasy Micro Kit with on-column DNase digestion (217084, Qiagen), as described in the manufacturer’s instructions. cDNA was generated from 10 to 25 ng of total RNA using Superscript III First Strand Synthesis Supermix (18080-400, Invitrogen); random hexamer primers were used for cDNA synthesis. A measure of 250 pg of cDNA were used as template for RT-qPCR in a 20-μl reaction containing 1 × PowerSybr Master Mix (ABI) and 1.25 μM Primers. Ct values were determined in triplicate on an ABI StepOnePlus instrument. Ct values were normalized to the expression of the housekeeping gene ACTB, and ΔΔCt values were utilized in detecting CHD8 expression differences. Primers were designed using Primer3 plus. The primer sequences are:
CHD8 (exon 4–5) forward primer (5′- CTGCACAGTCACCTCGAGAA -3′)
CHD8 (exon 4–5) reverse primer (5′- TGGTTCTTGCACTGGTTCAG -3′)
CHD8 (exon 36–37) forward primer (5′- TGAACTGTTTGGGAATGGAA -3′)
CHD8 (exon 36–37) reverse primer (5′- TGCTGCTCTCTGGTGCAATA -3′)
ACTB forward primer (5′- GGCATCCTCACCCTGAAGTA -3′)
ACTB reverse primer (5′- AGCACTGTGTTGGCGTACAG -3′).
+ Open protocol
+ Expand
2

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the miRNeasy Micro Kit with on-column DNase digestion (217084, Qiagen), as described in the manufacturer’s instructions. cDNA was generated from 10–25 ng of total RNA using Superscript III First Strand Synthesis Supermix (18080-400, Invitrogen); random hexamer primers were used for cDNA synthesis. 250pg of cDNA were used as template for RT-qPCR in a 20-μL reaction containing 1× PowerSybr Master Mix (ABI) and 1.25 μM Primers. Ct values were determined in triplicate on an ABI StepOnePlus instrument. Ct values were normalized to the expression of the housekeeping gene ACTB, and ΔΔCt values were utilized in detecting CHD8 expression differences. Primers were designed using Primer3 plus. The primer sequences are:
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!