Peasy t1 simple vector

The full-length cDNA of Bmgstd4 was cloned using a GeneRacer Kit (Invitrogen, Carlsbad, CA, USA) according to the user manual. Gene-specific primers and nested gene-specific primers for 5′- and 3′-rapid amplification of cDNA ends (RACE) were designed from known sequences [38 (link)]: 5′ GSP primer (5′ CTCTGCACCGGTCTGGTCGATGT 3′), 5′ nested GSP primer (5′ GGGTTCTTAGGGTACAACGCATCGTT 3′), 3′ GSP primer (5′ GAATCCTCAACATACCATACCGACT 3′) and 3′ nested primer (5′ ATCGACCAGACCGGTGCAGAGA 3′). RACE products were obtained from 1.5% agarose gels using gel extraction kits (Watson Biotechnologies, Shanghai, China), and purified fragments were cloned into pEasy-T1 simple vector (TransGen, Beijing, China) and sequenced (Sangon, Shanghai, China).

5′ and 3′ RACE analyses were performed using the GeneRacer kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction. Total RNA was extracted from three midguts of day three of the fifth instar silkworm larvae using Trizol reagent (Invitrogen, Carlsbad, CA, USA), followed by treatment of RNase-free DNase I (Promega, Fitchburg, WI, USA) for 30 min at 37 °C to eliminate the contaminating genomic DNA. The purity of extracted RNA was determined by UV spectrophotometer. Four μg of RNA was reverse-transcribed to the first strand of cDNA using M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) for 1 h at 42 °C. In order to obtain the full-length cDNA of the BmCDA7, specific primers were designed by primer 5 (Table S4), and then the procedure was performed using the GeneRacer kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. All the PCR products were electrophoresed on 2% agarose gels containing ethidium bromide and photographed under UV illumination. cDNA fragments were extracted from agarose gels, purified using a agarose gel purification kit (Axygen, Union City, CA, USA), and cloned to pEASY-T1 simple vector (TransGen, Beijing, China). The cloned product was sequenced using automated DNA sequencer (Applied Biosystems 3730, Shanghai, China).

To confirm the integration of the exogenic DNA fragment into the genome of transgenic E. acervulina, the flanking sequences of the 5′ integration site were identified using a genome walking kit (Takara, Dalian, China). The extraction and validation of genomic DNA from transgenic E. acervulina was performed according to the previously described methods [9 (link)]. Specific primers (SP) were designed according to E. tenella Sag13 promoter sequence as previously described [17 (link)]. PCR products of the third round were recovered and cloned into the pEASY-T1-simple vector (TransGen Biotech, Beijing, China). The sequencing results were analyzed by DNAStar7.0 software, and the integration sites in the genome were identified by performing a BLAST search in the E. acervulina DB database [22 (link)].

Integration site and expression of the exogenous DNA were investigated by genome walking analysis and Western blot. First, the flanking sequences of the 5′ integration site were identified using a genome walking kit (Takara, China). EmagER genomic DNA was obtained by phenol/chloroform extraction from sporozoites. Specific primers were obtained according to E. tenella His4 promoter sequence as previously described (7 (link)). PCR products of the last round were recovered and cloned into pEASY-T1-simple vector (TransGen Biotech), sequenced, and the results were analyzed by DNAStar 7.0 software. Twelve insertion site sequencing were conducted. Second, we applied Western blot to identify the “self-cleaving” effectiveness of P2A in transgenic parasites. Whole parasite soluble extracts were prepared from sporozoites as previously described (19 (link)). The lysis was centrifuged at 10,000 rpm for 10 min, and the supernatant was then subjected to SDS-PAGE and Western blot. Monoclonal antibody against His-tag (ABclonal) was applied. E. tenella GAPDH polyclonal antibody obtained and preserved in our lab was included as a loading control to ensure similar amounts of parasites’ soluble antigen were applied.

Total RNA was extracted from seedlings of maize inbred line K10 treated with 150 mM NaCl for 3 h using TRIzol reagent (TransGen, Beijing, China). First-strand cDNA was synthesized from 1 μg of total RNA with 1 μL (200 U) TransScript^TM RT/RI Enzyme Mix (TransGen), according to the manufacturer’s instructions. The primers for ZmNAC89 were performed using KOD-Plus-Neo (TOYOBO, Osaka, Japan) under the following conditions: 94 °C for 3 min, followed by 30 cycles of 94 °C for 45 s, 58.3 °C for 30 s, 72 °C for 1 min and 72 °C for 10 min. The resulting amplification product was subjected to gel purification and cloned to the pEASY-T1 Simple vector (TransGen), after which it was sequenced. The primers are listed in Supplementary Table S5.

WT, G4 Terc^-/- ES cells and WT ES cells treated with 1 µM 5-aza-dC for 2.5 days were analyzed for DNA methylation of mouse Zscan4c promoter and Tcstv1/Tcstv3 promoter. HeLa and U2 OS cells were used to analyze for DNA methylation of human ZSCAN4 promoter. Briefly, 1 µg of genomic DNA was subject to sodium bisulfite conversion using the EpiTect Bisulfite kit (QIAGEN). Mouse Zscan4c promoter and human ZSCAN4 promoter were amplified using the following bisulfite primers. For mouse Zscan4c promoter, forward: GATTAGATTTTGAAGAATATATTTTTTGTG; reverse: CCTCCAATATAACAAAACCCTTAAC. For mouse Tcstv1/3 promoter, forward: TTGGTATATTTGGTGGGTTAAGAAG; reverse: AATCCACAATTCTCCTTCAAAAATA. For human ZSCAN4 promoter, forward: TGGTTTTTATAGGTTTTGTATAGATT; reverse: AAAACTAAAATCCCCTACCAACTTC. The PCR products were cloned into the pEasy-T1 simple vector (Transgene) through TA cloning, and 8–15 colonies were randomly picked and sequenced and analyzed for each sample.