Q5 hot start high fidelity

Two gRNA target sites were selected within the first coding exon of the bnl using the flyCRISPR Optimal Target Finder tool and were designed following the recommendations ((Gratz et al., 2014 (link)), Figure 2A). All the candidates were evaluated by setting “maximum stringency” and “NGG only” for “PAM”. Two sites with no potential off-targets were selected and sequence verified to ensure no mutations in the genome of the parent fly stocks selected for injection (nos-Cas9 (on X chromosome), BL# 54591). Also, the potentially “good” activities of both gRNAs were predicted using the software tool described in (Doench et al., 2014 (link)). Two gRNAs that matched all those criteria (PAM sequence underlined) were:
gRNA1: TGTATCTGCGATGCCCCTCATGG gRNA2:
ATCCTTCAGATATTGCGGGATGG
These gRNAs were expected to delete a 835 nucleotide (nt) region of the coding exon. The gRNAs were cloned using Gibson Assembly (NEB) of the PCR products (amplified with primers listed in Table 2) into a pCFD4 RNA expression vector following a gRNA cloning protocol (Port et al., 2014 (link)). All PCR reactions were carried out either with KAPA HiFi Hot Start- (Kapa Biosystems) or Q5 Hot Start High Fidelity- (NEB) DNA polymerase following the manufacturers' protocol. For gel purification or clean-up of the PCR products, purification kits from Zymo Research were used.