Improm iitm reverse transcription system

Total RNA from RPE cells was isolated using TRIzol reagent (Life Technologies), treated with RQ1 RNase-free DNase before cDNA synthesis using the ImProm-II^TM Reverse Transcription System (Promega, Southampton, UK). cDNA was amplified using the Power SYBR® Green PCR Master Mix Reagent (Life Technologies) on a StepOne™ Applied Biosystems Real-Time PCR System. Primer sequences used were: β-actin, forward 5′-AGC CAT GTA CGT AGC CAT CC, reverse 5′-CTC TCA GCT GTG GTG GTG AA; Beclin 1, forward 5′-CAG GAA CTC ACA GCT CCA TTA C, reverse 5′-CCA TCC TGG CGA GTT TCA ATA; IL-1RI, forward 5′-AGG TGG AGG ACT CAG GAT ATT, reverse, 5′-CCA GGG TCA TTC TCT AAC ACA G; IL-1RII, forward 5′-CTG ATA GTC CCG TGC AAA GT, reverse 5′-GGG TAA GCA GCC GAG ATA AA; IL-1Ra, forward 5′-TTG TGC CAA GTC TGG AGA TG, reverse 5′-CTC AGA GCG GAT GAA GGT AAA G; IRAK1, forward 5′-CAG AGG TGG AAC AGC TAT CAA G, reverse 5′-CAT TGG GCA AGA AGC CAT AAA C; and IRAK3, forward 5′-CAA CAA AGC CCA CCA TCA TTA C, reverse 5′-GCA TTT GAG CAA CTT CCC TAT G.

First, a DNA digestion was performed using DNAse I (#4716728001, Roche) to remove genomic DNA. Therefore, all samples were supplemented with DNAse I and incubated at 37°C for 30 min. Reaction was stopped by incubating all samples at 75°C for 10 min. Afterwards, cDNA synthesis was conducted by using the ImProm-IITM Reverse Transcription System (#A3800, Promega), following the manufacturer’s instructions. For cDNA synthesis, a total amount of 100 ng RNA was used.

Total RNA extraction was carried out using TRIzol™ Reagent (Life Technologies, UK) according to the manufacturer's instructions. Total RNA was quantified by NanoDrop, and cDNA was synthesized using the ImProm‐IITM Reverse Transcription System (Promega). Then, cDNA was amplified using the Power SYBR^® Green PCR Master Mix Reagent (Life Technologies). Primer sequences used were as follows: β‐Actin, forward 5′‐gggaaatcgtgcgtgacattaag, reverse 5′‐tgtgttggcgtacaggtctttg; NPY, forward 5′‐actccgctctgcgacactacat, reverse 5′‐gcgttttctgtgctttccttca; VEGF, forward 5′‐ttactgctgtacctccacc, reverse 5′‐acaggacggcttgaagatg; Angiopoietin‐like 4 protein (ANGPTL‐4) and forward 5′‐ttggtacctgtagccattcc, reverse 5′‐gaggctaagaggctgctgta. The equation fold change = 2−ΔΔct was used for calculation relative changes in expression levels.

Total RNA was extracted from BV2 cells using Trizol reagent (Ambion, Invitrogen) with a DNase (Promega, Madison, WI, USA) treatment according to the manufacturer’s instructions. cDNA synthesis from 1 μg of total RNA in a reaction volume of 20 μl was performed with ImProm-IITM Reverse Transcription System (Promega, Madison, WI, USA) according to the manufacturer’s instructions. PCR amplification with specific primers was utilized following thermal cycling: 95 °C for 10 min, 35 cycles of denaturing at 95 °C for 1 min, annealing at 64 °C for 1 min, elongation at 72 °C for 1 min, final extension at 72 °C for 7 min and holding at 4 °C. PCR products were electrophoresed in 1% agarose gels. All samples were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The following primers were used: AdipoR1: forward (5′-AACTGGACTATTCAGGGATTGC-3′), reverse (5′-ACCATAGAAGTGGACGAAAGC-3′); AdipoR2: forward (5′-CCACCATAGGGCAGATAGG-3′), reverse (5′-TGAACAAAGGCACCAGCAA-3′); GAPDH: forward (5′-AAGCCCATCACCATCTTCCAG-3′), reverse (5′-AGAAGACTGTGGATGGCCCCT-3).

The total RNA was isolated from DF1 or ICP1 cells using TRIzol reagent (Invitrogen, USA), and the cDNA was generated with the ImProm-II^TM Reverse Transcription System (Promega, USA). RT-qPCR was performed using a SYBR Green PCR Master Mix (Roche, USA) on the 7500 Real-Time PCR System (Applied Biosystems, USA). The NONO gene was used as an internal control. The expression data were calculated using the 2^−ΔΔCT relative quantification method. The primers used are shown in Table 1.

Total RNA was extracted using TRIzol reagent (Ambion, CA, USA). A total of 1 μg of RNA was reverse-transcribed using the ImProm-IITM Reverse Transcription System (Promega, WI, USA). Quantitative real-time RT-PCR was conducted using SYBR GREEN qPCR Super Mix (Invitrogen, CA, USA). A standard amplification protocol was used according to the supplier’s directions. Primers were listed as following.

SLC3A2 forward: 5′-TGAATGAGTTAGAGCCCGAGA -3′;

SLC3A2 reverse: 5′-GTCTTCCGCCACCTTGATCTT -3′;

GAPDH forward: 5′- AGACAGCCGCATCTTCTTGT-3′;

GAPDH reverse: 5′- CTTGCCGTGGGTAGAGTCAT-3′;

Total RNA was extracted from tissue samples or cells using TRIzol reagent (Invitrogen). Total RNAs were quantified using a NanoDrop ND-1000 spectrophotometer. After incubation for 15 min at 37°C with 3 U/μg of RNase R (Epicentre Biotechnologies, Madison, WI, United States), the RNA was used to obtain cDNA using the ImProm-IITM Reverse Transcription System (Promega, Madison, WI, United States). Random primers were used for reverse transcription to detect circRNAs. To detect miRNA expression, the primers used for reverse transcription and PCR detection were designed based on the stem-loop principle. Quantitative RT-PCR (RT-qPCR) analysis was performed using SYBR GREEN qPCR Super Mix (Promega, United States). The primers used for RT-qPCR are shown in Supplementary Table S2. GAPDH was used as an internal control for circRNAs and mRNAs. U6 was used as an internal control for miRNAs. The RT-qPCR assay was performed using three independent replicates. Relative expression level of RNA was calculated using the 2^–ΔΔCt method, in which one sample from the FGR or normal group was randomly chosen and set to 1.