Platinum taq

DNAs from cells were extracted using DNeasy (QIAgen). DNA (100 ng) was bisulfite converted using an EZ DNA Methylation Gold Kit (Zymo). Bisulfite converted DNA was eluted in 30 μl water, of which 10 μl was used for a 40 μl PCR reaction containing 1x Buffer, 1.5 mM MgCl₂, 250 nM each dNTPs, 12.5 μg BSA, 6.25% DMSO, 5 units of Platinum Taq (Lifetech), 400 nM of forward and reverse primers (TertMut_BSF2_forward 5′-GAAAGGAAGGGGAGGGGTTGGGAGGG and TertMut_BSF2_reverse 5’-CCTCCACATCATAACCCCTCCCT) and 5 units of Platinum Taq (Lifetech). The following cycling conditions were used: 1 cycle of 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min; and 1 cycle of 72 °C for 5 min. Products were run on a 2% agarose gel, excised and cloned into the pCR2.1-TOPO vector system (Lifetech). The vectors were transformed in TOP10 chemically competent cells (Lifetech). Plasmid DNA was purified from colonies using a Plasmid Purification Kit (Qiagen), and subsequently analyzed by Sanger sequencing. Sanger bisulfite sequencing data were analyzed using a custom Java program called DNAMethylMap, which facilitates the analysis of Sanger bisulfite sequencing clones with virtually bisulfite converted reference amplicon sequences (B.K., S.Y., unpublished).

Three PCRs were performed for each sample. The primers MiSeq341F (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′) and MiSeq805R (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHV GGGTATCTAATCC-3′) were used. The 3′ ends of the primers amplify regions V3 and V4 of the 16S gene (Herlemann et al., 2011 (link)), while the 5′ ends are Illumina^® adapter sequences for MiSeq™ (Illumina, San Diego, CA, USA). Three independent PCR reactions were performed for each sample and then pooled before sequencing. PCR were carried out in a final volume of 20 µl containing 250 µM dNTPs, 0.5 µM of each primer, 0.02 U Taq Platinum (Invitrogen, Carlsbad, CA, USA), and 10X Taq Platinum buffer containing 1.5 mM MgCl₂. The protocol used for PCR reactions was as follows: initial denaturation at 95 °C for 3 min, followed by 25 cycles consisting of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 1 min, and a final extension step at 72 °C for 5 min. PCR products were purified with a High Pure PCR Product Purification Kit (Roche Diagnostics GmbH, Mannheim, Germany).

A 330 bp sequence belonging to the hypervariable region of T. cruzi kDNA was amplified as reported (Schijman et al., 2011 (link)). Briefly, the master mix was composed by 1X Taq platinum amplification buffer, 200 µM dNTPs, 3 mM MgCl₂ solution, 1.5 U Taq platinum (Invitrogen, Brazil), 10 µM kDNA specific primers 121 (AAATAATGTACGGGKGAGATGCATGA) and 122 (GGTTCGATTGGGGTTGGTGTAATATA), 5 µl of template DNA, and a quantity of water sufficient to give a final volume of 50 µl. Cycling parameters were one step of 3 min denaturation at 94°C; 2 cycles of 1 min at 97.5°C, 2 min at 64°C; 33 cycles of 1 min at 94°C, 1 min at 62°C and one final extension step of 10 min at 72°C. The kDNA-PCR products were analyzed in 2% agarose gels stained with ethidium bromide.

Peripheral blood from infected treated and untreated mice was obtained by retro-orbital venipuncture after completing the drug treatments at 3 months post-infection (n = 5 samples per treatment). The samples were mixed with an equal volume of guanidine-HCl 6 M, EDTA 0.1 M, pH 8, kept at room temperature for 1 week and then at 4°C until use. The PCR was performed with primers 121 and 122 (121 AAATAATGTACGGG(T/G)GAGATGCATGA, 122 GGTTCGATTGGGGTTGGGTAATATA), which amplify a 330-bp sequence from kinetoplast DNA (k). The amplification reactions were achieved in a volume of 25 μl, consisting of 2.5 μl of the 10× Taq Platinum buffer (100 mM Tris–HCl, pH 8.3; 500 mM KCl), 2.5 μl of a dNTP mixture (200 M of each), 2.5 μl of each primer, 0.2 µl of Taq Platinum (Life Technologies, NY, USA), 1.75 μl of MgCl₂ solution and 5 μl (approximately 100 ng) of DNA per sample. Gel electrophoresis was performed using 2% agarose and TAE buffer in the presence of 0.5 g/mL of ethidium bromide. The detection limit was 0.002 parasites per assay, equivalent to 2 parasites/5 mL [15 (link)].

The PA gene was amplified from viral RNA using the SuperScript III One‐step RT‐PCR system with Platinum Taq (Thermo Fisher Scientific) and universal primers.17 A DNA library was prepared from RT‐PCR products using a QIAseq FX DNA Library Kit (Qiagen), followed by purification by Agencourt AMPure XP (Beckman Coulter). The library was sequenced with MiSeq Reagent Kits v3 and the MiSeq system (Illumina). Sequence reads were aligned to reference sequences using CLC Genomics Workbench 11 (Qiagen). A minor allele frequency threshold of 10% was used for the detection of SNPs. All sequences are available from the EpiFlu database of the Global Initiative on Sharing All Influenza Data (GISAID) (Table 3).

Total RNA was isolated from mouse adipose tissue using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. RNA (3 μg) was reverse transcribed using the Thermoscript RT-PCR system (Invitrogen) and oligo dT primers. Plin5 cDNA was PCR amplified using Platinum Taq (ThermoFisher Scientific, Melbourne, Australia) with the following primers: mouse Plin5 (forward: GAC GGT ACC ATG GAC CAG AGA GGT GAA GAC ACC ACCC; reverse: TAG GAA TTC TCA GAA GTC CAG CTC TGG CAT TGTG). cDNA was cloned into a pcDNA3.1 vector (ThermoFisher Scientific) through BamHI and EcoRI sites. Murine Plin5 underwent site-directed mutagenesis using pfx polymerase (Invitrogen) to generate serine to alanine substitutions as follows: Peptide S155A forward: CGG CGT TGG GCT GGG GAG CTG AGG CGC TCC, reverse: CAG CTC CCC AGC CCA ACG CCG GCC CCT TTGG, S161A forward: CTG AGG CGC GCC ATG AGT CAA GCC ATG GAC, reverse: CTT GAC TCA TGG CGC GCC TCA GCT CCC CAC, S163 forward: GCG CTC CAT GGC TCA AGC CAT GGA CAT GGTG, reverse: CAT GGC TTG AGC CAT GGA GCG CCT CAG CTCC.