Mouse primary cortical neurons were transfected with vector, HA-Ub, or Flag-RNF8 plasmids for 36 h, and then treated with 10 μM MG132 for 8 h. Cells were collected and lysed with RIPA lysis buffer (P0013C, Beyotime). Next, 100 μL of cell lysate was incubated with anti-HDAC2 antibody (ab32117, 1:60, Abcam) for 2 h at 4 °C and with 10 μL Protein A Agarose beads overnight. The protein on the beads was extracted, and the ubiquitination level of Ub was detected using anti-HA antibody. At the same time, anti-Flag antibody (ab205606, 1:2000, Abcam) was used to detect the level of Flag and anti-HDAC2 antibody (ab32117, 1:2000, Abcam) was used to detect the level of RNF8 and HDAC2 proteins in cell lysate.
Ab32117
Manufactured by Abcam
Sourced in United Kingdom
Ab32117 is a lab equipment product manufactured by Abcam. It is a highly specific and sensitive immunodetection reagent designed for use in various research applications.
Automatically generated - may contain errors
Lab products found in correlation
Ab32369, by Abcam (6 mentions)
Ab109411, by Abcam (5 mentions)
Ab19845, by Abcam (3 mentions)
Ab8245, by Abcam (3 mentions)
Ripa lysis buffer, by Beyotime (2 mentions)
Ab172730, by Abcam (2 mentions)
Image pro plus 6, by Media Cybernetics (2 mentions)
Ab32096, by Abcam (2 mentions)
Green fluorescent conjugated secondary antibody, by Transgene (2 mentions)
Ab6721, by Abcam (2 mentions)
Ab177793, by Abcam (2 mentions)
Protease inhibitor cocktail, by Merck Group (2 mentions)
Ab205606, by Abcam (1 mentions)
Neutral buffered formalin, by Merck Group (1 mentions)
Cst4060, by Cell Signaling Technology (1 mentions)
Sc 81598, by Santa Cruz Biotechnology (1 mentions)
Ab133493, by Abcam (1 mentions)
Sc 133225, by Santa Cruz Biotechnology (1 mentions)
Ab181544, by Abcam (1 mentions)
Af519, by Beyotime (1 mentions)
27 protocols using ab32117
1
Investigating HDAC2 Ubiquitination in Neurons
2
Tissue Fixation and Immunohistochemistry Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues and organoids were fixed with 10% neutral‐buffered formalin (Sigma–Aldrich) at room temperature for 24 h or 0.5 h, respectively. The paraffin embedding was performed as follows: samples went through a graded‐ethanol series, xyleneand then paraffin. The embedded samples were cut into 5 μm and prepared for H&E and immunohistological (IHC) staining according to a standard protocol. For IHC, primary antibodies against CK7 (NBP2‐44814, Novus Biologicals, 1:50), histone deacetylase (HDAC1) (sc‐81598, Santa Cruz, 1:50), HDAC2 (ab32117, Abcam, 1:100), HDAC3 (ab32117, Abcam, 1:100), HDAC4 (sc‐46672, Santa Cruz, 1:50), HDAC5 (sc‐133225, Santa Cruz, 1:50), HDAC6 (ab133493, Abcam, 1:100), cleaved‐Caspase3 (CST‐9579, Cell Signaling Technology, 1:100), Ki‐67 (CST‐12202, Cell Signaling Technology, 1:100), acetyl‐Histone H3 (Lys18) (CST‐131998, Cell Signaling Technology, 1:100) and p‐AKT (CST‐4060, Cell Signaling Technology, 1:100) were used.
3
Immunoprecipitation and Immunoblotting for GATA1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Before the collection of protein extracts, cells were dissolved in lysis buffer. The cell lysis buffer was mixed with Flag M2-affinity gel-conjugated GATA1 antibody at 4°C for 12 h. After that, the protein was gradually eluted by KCl-contained buffer. The lysates (approximately 300 µg protein) were incubated with fresh protein A-beads (35 µL, #9863, CST) and 1 µg anti-GATA1 (1:1,000, ab181544, Abcam), anti-Flag (1:500, AF519, Beyotime) or IgG (1:500, ab172730, Abcam) at 4°C for 3 h. The magnetic beads were lysed in lysis buffer and loaded in SDS-PAGE. The immunoprecipitated proteins were reacted with anti-HDAC1 (1:1,000, ab109411, Abcam), anti-HDAC2 (1:1,200, ab32117, Abcam) and anti-HDAC3 (1:2,000, ab32369, Abcam). The immunoblot reactions were performed as described previously [25 (link)].
4
Quantitative Immunofluorescence Analysis of HDAC Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animals were intracardially perfused with PBS and 4% paraformaldehyde. After fixation, dissected brains were cryoprotected in 20% sucrose overnight at 4°C and then in 30% sucrose at 4°C. Coronal sections of 20 μm were obtained using a cryostat and further processed for immunohistochemistry. Briefly, slices were incubated in blocking fluid (Beyotime) to permeabilize and block unspecific staining. Primary antibodies were incubated for 48 h at 22–24°C and secondary antibodies overnight at 4°C. Both primary and secondary antibodies were diluted in blocking fluid (Beyotime). Rabbit anti-HDAC1 (ab19845, Abcam, 1:1,000), anti-HDAC2 (ab32117, Abcam, 1:250), and anti-HDAC3 (ab32369, Abcam, 1:100) were used as primary antibodies. All secondary antibodies Alexa 488 (Invitrogen) was diluted 1:1,000. Immunofluorescence labeling of a specific protein was used to determine its localization with the cells. Immunofluorescence images were captured using laser scanning confocal microscope (FV3000, Olympus, Japan). Left or right CeA was imaged. Integrated optical density (IOD) of the specific protein was analyzed using the Image-Pro Plus 6.0 software (Media Cybernetics, United States). The relative concentration of the labeled protein was quantified by specific thresholding of the fluorescent region of interest and by measuring the IOD of the fluorescent signal.
5
Quantifying FTO and ALKBH5 Abundance in Uterine Leiomyosarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunohistochemistry (IHC) was performed as described previously [77 (link)]. The primary antibodies FTO (Abcam, Ab109411, Cambridge, UK) and ALKBH5 (Abcam, Ab 32117) were used for IHC. To determine the percentage and intensity of FTO- and ALKBH5-positive cells, QuPath software (version 0.2.3) (https://qupath.github.io , accessed on 15 November 2022) was used with the positive cell detection command. Thresholds were set to categorize cells according to nuclei staining intensity: negative, weak, moderate, and strong intensity. The histochemical scoring (H-score) captures both the intensity and the proportion of the FTO/ALKBH5-positive cells from the IHC image and comprises values between 0 and 300 [78 (link)], thereby offering a dynamic range to quantify FTO/ALKBH5 abundance between myometrium and uLMS. Human testis tissues were used as positive tissues for FTO and ALKBH5 staining.
6
Immunoprecipitation of Sox9 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclear lysates were prepared as described above for sample preparation for MS. IP was performed by adding anti-Sox9 antibody at 4 °C, and the supernatant was used for IP with rabbit anti-Sox9 (EMDMillipore, ab5535) or rabbit anti-IgG (R&D Systems, AB-105-C) overnight at 4 °C. Subsequent pull-down was performed by adding protein A agarose beads (ThermoFisher, 15918-014) for an additional 5 h at 4 °C. The beads were collected, washed, and boiled in 2× SDS gel loading dye to elute immunoprecipitated proteins, which were analyzed by Western blot. Inputs (10% of lysate) and immunoprecipitated proteins from the anti-IgG and anti-Sox9 IPs were run on a 10% SDS polyacrylamide gel, followed by wet transfer to nitrocellulose membrane at 400 mA for 45 min. The membrane was blocked by 5% milk in Tris-buffered saline with Tween20 (TBST), followed by incubation overnight at 4 °C in the primary antibodies anti-Sox9 (EMDMillipore, ab5535), anti-Hdac2 (Abcam, ab32117), and anti-Mta2 (Abcam, ab8106) at 1:1,000 dilution. The next day, membranes were washed three times with TBST, incubated at room temperature for 1 h in horseradish peroxidase–conjugated anti-rabbit IgG at 1:2,000 dilution in 5% milk, washed again three times with TBST, and developed using luminol reagent (Santa Cruz Biotechnology, sc2048).
7
Quantifying HDAC2 Activity in Stroke Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HDAC activity in peri‐infarct cortical samples was measured according to the manufacturer's protocol (EMD Millipore). For HDAC2‐specific activity, immunoprecipitation with HDAC2 antibody was performed before the assay as described previously.21 Briefly, tissue lysates prepared in immunoprecipitation buffer (50 mmol/L Tris‐HCl, 150 mmol/L NaCl, 5 mmol/L EDTA, 0.5% NP‐40, pH 8.0, supplemented with 1 mmol/L phenylmethyl sulfonylfluoride (PMSF)) were incubated with 0.5 μL mouse anti‐HDAC2 (ab32117, Abcam), and 20 μL protein G‐Agarose (Sigma) overnight on a tube rotator at 4°C. Then beads were centrifuged at 5000g and washed 5 times in PBS. HDAC assay substrate was added to the beads and incubated at 30°C for 40 minutes. Finally, activator solution containing trichostatin A (HDAC inhibitor) was used to stop the reaction, and the supernatant was used for fluorescent measurement. Fluorescent was measured in 384 wells plate by excitation wavelength 360 nm and emission wavelength 450 nm using a fluorescence plate reader (Molecular Devices). HDAC activity was normalized to total protein levels determined by Bradford assay.
8
HDAC2 miRNA Binding Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RIP assays were performed using the Magna RIP TM RNA-binding protein immunoprecipitation kit (Merck, 17-701) according to the manufacturer’s instructions. HPCs were lysed using RIP lysate, and 5 μg of HDAC2 antibody (ab32117, Abcam, 1:60) was pre-conjugated to protein A/G magnetic beads in immunoprecipitation buffer for 2 h, followed by incubation with 100 μL of cell lysates for 16 h at 4 C. IgG antibody (bs-0297P; Bioss) was used as a negative control. Co-precipitated RNA was extracted and evaluated by qRT-PCR. hsa-miR-223-3p forward primer TGTGTGGTGTCAGTTTGTCAAAT, universal primer Qiagen (Cat No. 1046471), designed by Primer Premier, was synthesized by Beijing DynaScience Biology.
9
Western Blot Analysis of Histone Deacetylases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was extracted in NP-40 lysis buffer (Boster, Wuhan, China), separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto 0.45 μm PVDF membrane (Millipore). The following primary antibodies were used in the immunoblotting assays: antibodies for YY1 (ab12132, Abcam), HDAC1 (ab109411, Abcam), HDAC2 (ab32117, Abcam), HDAC3 (ab32369, Abcam) and GAPDH (AG019, Beyotime). The quantitative analysis for western blot was conducted by using Image-J Software (NIH, Bethesda, MD, USA).
10
Quantifying Synaptic Proteins via Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot analysis was performed as previously described in detail.19 Briefly, peri‐infarct cortex tissue was rapidly dissected around the stroke infarct core over the ice box as shown in Figure S2 .9 The equivalent region of cortex was taken in sham mice. The primary antibodies were as follows: Rabbit anti‐HDAC2 (1:2000, ab32117, Abcam), rabbit anti‐HDAC3 (1:2000, ab16047, Abcam), rabbit anti‐histone H4 (1:500, ab10158, Abcam), rabbit anti‐acetylated histone H4 (acetyl‐K5) (1:1000, ab51997, Abcam), mouse anti‐Flag (1:1000, F1804, Sigma), rabbit anti‐synapsin (1:1000, AB1543, Millipore), rabbit anti‐spinophilin (1:2000, 06‐852, Millipore), or rabbit anti PSD‐95 (1:1000, 2507, CST). Mouse anti‐GAPDH (1:4000, KC‐5G4, KangChen Bio‐tech) or mouse anti‐β‐actin (1:4000, A1978, Sigma) was used as internal control. Appropriate horseradish peroxidase–linked secondary antibodies were used for detection by enhanced chemiluminescence (Pierce).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!