Gdc0032

Manufactured by Selleck Chemicals

Sourced in United States

GDC0032 is a laboratory chemical reagent. It is a solid compound used in various scientific research and analytical applications. The core function of GDC0032 is to serve as a chemical standard or reference material for analytical procedures.

Automatically generated - may contain errors

Lab products found in correlation

13 protocols using gdc0032

Comparison of PI3K Inhibitors in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

BKM120, BYL719, and GDC-0032 were all purchased from Selleckchem and given via oral gavage in 100 μl. The mice were given 0.5% carboxymethyl cellulose (CMC) as vehicle control or PI3K inhibitors (BKM120: 30 mg/kg, BYL719: 30 mg/kg, and GDC-0032: 20 mg/kg) by gavage for 15 days (5 out of 7 days). The mice were euthanized after the treatment to check the transcriptional profiles of DLPs by RNA-seq analyses.

Lee Y.R., Chen M., Lee J.D., Zhang J., Lin S.Y., Fu T.M., Chen H., Ishikawa T., Chiang S.Y., Katon J., Zhang Y., Shulga Y.V., Bester A.C., Fung J., Monteleone E., Wan L., Shen C., Hsu C.H., Papa A., Clohessy J.G., Teruya-Feldstein J., Jain S., Wu H., Matesic L., Chen R.H., Wei W, & Pandolfi P.P. (2019). Reactivation of PTEN tumor suppressor for cancer treatment through inhibition of a MYC-WWP1 inhibitory pathway. Science (New York, N.Y.), 364(6441), eaau0159.

+ Open protocol

+ Expand

Cell Line Characterization and Compound Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols

T47D, MCF7 cells were purchased from American Type Culture Collection (ATCC) in 2012 - 2015. They were authenticated using STR testing and tested negative for Mycoplasma contamination. EFM19, BT474, MDAMB453, HCC202, MDAMB361, HCC1419, MDAMB415, HCC1937, CAL51, BT20, HCC1954, and JIMT1 cells were purchased from Cancer Cell Line Encyclopedia (CCLE) at the Broad Institute in 2015-2016, and were authenticated using SpectroCHIPII-G384 by Sequenom's MassARRAY Analyzer Compact. All the cells were maintained in RPMI-1640 with 10% fetal bovine serum. BYL719, GDC0941, BKM120, AZD1208, GDC0032, PI-103, BX795, BX912, MK2204, GDC0068, sirolimus, everolimus, PP242 and WYE were purchased from Selleck Chemicals (Supplementary Material and Methods). Blasticidine was purchased from Life Technologies. LGH447 was obtained from Novartis.

Le X., Antony R., Razavi P., Treacy D.J., Luo F., Ghandi M., Castel P., Scaltriti M., Baselga J, & Garraway L.A. (2016). Systematic functional characterization of resistance to PI3K inhibition in breast cancer. Cancer discovery, 6(10), 1134-1147.

+ Open protocol

+ Expand

Trametinib and inhibitor evaluation

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Trametinib (GSK1120212), MK2206 (PubChem compound database (CID, 24964624)), GDC0032 (25 (link)), TGX221 (26 (link)), BYL710 (25 (link)) and IPI145 (25 (link)) were purchased from Selleck Chemicals (Houston, TX). Recombinant human HGF was purchased from PeproTech (Rocky Hill, NJ) and used at 10 ng/ml based on our previous studies (20 (link)). The neutralizing and internalizing anti-cMET antibody, LY2875358, and the cMET/RON inhibitor, LY2801653 (27 ), were provided by Eli Lilly and Company (Indianapolis, IN).

Cheng H., Chua V., Liao C., Purwin T.J., Terai M., Kageyama K., Davies M.A., Sato T, & Aplin A.E. (2017). Co-targeting HGF-cMET signaling with MEK inhibitors in metastatic uveal melanoma. Molecular cancer therapeutics, 16(3), 516-528.

+ Open protocol

+ Expand

Breast and Kidney Cell Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Authenticated MCF7, T47D, MCF10A, HCC1500, and 293T cells were purchased from ATCC and used for experiments within the first 10 passages. Cultures were checked for Mycoplasma every 6 months (Lonza) and cells maintained at 37°C and 5% CO₂ in RPMI or DMEM + 10% FBS and 1% Pen-Strep. GDC-0941, BYL719, GDC-0032, and GDC-0068 were purchased from Selleck, and MI-136, MI-503, and MM-102 were purchased from Cayman. siRNAs (Silencer Select) were purchased from Invitrogen (Negative control #1, 4390843; siKMT2D, s528766).

Jones R.B., Farhi J., Adams M., Parwani K.K., Cooper G.W., Zecevic M., Lee R.S., Hong A.L, & Spangle J.M. (2022). Targeting MLL Methyltransferases Enhances the Antitumor Effects of PI3K Inhibition in Hormone Receptor–positive Breast Cancer. Cancer Research Communications, 2(12), 1569-1578.

+ Open protocol

+ Expand

Preparation of Drug Solutions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Novartis Pharma AG (Basel, Switzerland) provided BYL719 and AEW541. GDC0032 was purchased from Selleckchem (Houston, TX, USA). For in vitro experiments, all drugs were dissolved in DMSO, and for in vivo administration, in 0.5% carboxymethylcellulose. Human IGF2 recombinant protein was purchased from Cell Signaling Technology (#5238) and dissolved in sterile water.

Badarni M., Prasad M., Golden A., Bhattacharya B., Levin L., Yegodayev K.M., Dimitstein O., Joshua B.Z., Cohen L., Khrameeva E., Kong D., Porgador A., Braiman A., Grandis J.R., Rotblat B, & Elkabets M. (2021). IGF2 Mediates Resistance to Isoform-Selective-Inhibitors of the PI3K in HPV Positive Head and Neck Cancer. Cancers, 13(9), 2250.

+ Open protocol

+ Expand

Doxycycline-Inducible SGK1 Knockdown

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reagents such as BYL719, GDC0941, MK2206, BKM120, GDC0032 were purchased from Selleckchem. SGK1-inh was a gift from M. Nazare and N. Halland, dissolved in DMSO. GDC0077 was a kind gift under an MTA with Genentech, Inc.
Plasmids pLenti7.3-V5-SGK1 (Δ60, S422D) and control vector pLenti7.3luc were cloned in house as described by (Fellmann et al., 2013 (link)). Lentiviral doxycycline-inducible mirE-embedded shRNAs were cloned into the LT3GEPIR vector. This all-in-one vector contains the puromycin resistance and the reverse transactivator (rtTA3) under the control of PGK promoter. SGK1 shRNA was chosen experimentally based on five different hairpins validated at Castel et al., 2016 (link).
SGK1#282shRNA: 5^′TGCTGTTGACAGTGAGCGCAGAAGTGTTCTATGCAGTCAATAGTGAAGCCACAGATGTATTGACTGCATA GAACACTTCTTTGCCTACTGCCTCGGA-3^′.

Toska E., Castel P., Chhangawala S., Arruabarrena-Aristorena A., Chan C., Hristidis V.C., Cocco E., Sallaku M., Xu G., Park J., Minuesa G., Shifman S.G., Socci N.D., Koche R., Leslie C.S., Scaltriti M, & Baselga J. (2019). PI3K Inhibition Activates SGK1 via a Feedback Loop to Promote Chromatin-Based Regulation of ER-Dependent Gene Expression. Cell reports, 27(1), 294-306.e5.

+ Open protocol

+ Expand

Evaluating Small Molecule Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pemigatinib (Cat# T12401), BGJ398 (infigratinib, Cat# T1975) and quisinostat (Cat# T6055) were purchased from TargetMol Chemicals (Boston, MA). Gemcitabine (Cat# LY-188011), panobinostat (Cat# LBH589), T6061 (LMK-235, Cat# S7569), trichostatin A (Cat# S1045), PF-04691502 (Cat# S2743), GDC-0032 (Taselisib, Cat# S7103), ciclopriox olamine (Cat# S3019), S-Ruxolitinib (Cat# A2902), SP2509 (Cat# S7680), dinaciclib (Cat# S2768), and Trametinib (Cat# S2673) were purchased from Selleck Chemicals (Houston, TX).

Lidsky M.E., Wang Z., Lu M., Liu A., Hsu S.D., McCall S.J., Sheng Z., Granek J.A., Owzar K., Anderson K.S, & Wood K.C. (2022). Leveraging patient derived models of FGFR2 fusion positive intrahepatic cholangiocarcinoma to identify synergistic therapies. NPJ Precision Oncology, 6, 75.

+ Open protocol

+ Expand

Kinase Inhibitors for Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The small-molecule kinase inhibitors used included the PI3K catalytic inhibitors GDC-0941 (Cayman Chemical, 11600)^{44 (link)} and GDC-0032 (Selleck Chemicals, S7103)^{45 (link)} and BYL-719 (Active Biochem, A-1214)^{46 (link)}, the AKT catalytic inhibitor GDC-0068 (Selleck Chemicals, S2808)^{47 (link)}, and the AKT allosteric inhibitor MK-2206 (Cayman Chemical, 1032350-13-2)^{48 (link)}. Note that AKT catalytic inhibitors are known to increase AKT phosphorylation on threonine 308 and serine 473 by stabilizing a conformation in which these phosphorylated residues are inaccessible to phosphatases while, at the same time, fully inhibiting AKT kinase activity and phosphorylation of downstream substrates^{49 (link)}. Inhibitor stocks were dissolved in DMSO at 10 mM under sterile conditions, aliquoted and stored at −80 °C. Aliquots were freeze–thawed no more than five times. Insulin/growth factor treatments were preceded by 15 min of pretreatment with DMSO (Thermo Fisher Scientific, BP231-100) or a small-molecule inhibitor dissolved in DMSO. The inhibitors or DMSO were also present in the medium during labelling.

Dibble C.C., Barritt S.A., Perry G.E., Lien E.C., Geck R.C., DuBois-Coyne S.E., Bartee D., Zengeya T.T., Cohen E.B., Yuan M., Hopkins B.D., Meier J.L., Clohessy J.G., Asara J.M., Cantley L.C, & Toker A. (2022). PI3K drives the de novo synthesis of coenzyme A from vitamin B5. Nature, 608(7921), 192-198.

+ Open protocol

+ Expand

Multiparametric Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibodies anti-pAKT Ser473 (#4060), anti-pAKT thr308 (#9275), anti-AKT (#4691), anti-pS6 S235/236 (#4858), anti-pS6 S240/244 (#5364), anti-S6, anti-pERK1/2 Thr202/Tyr204 (#9101), and anti-ERK1/2 (#4695) were from Cell Signaling Technology. Anti-LC3B was obtained from Sigma-Aldrich (L8918). KI67 was purchased from Vector laboratories (#VP K451). Anti-Actin was from MP Biomedicals (691001). Novartis Pharma AG (Basel, Switzerland) provided BYL719 and AEW541. LDE225, MK2206, AZD6482,AZD6738, GDC0032, PHA-665752, 17-AAG, LEE011, LY2835219, LBH589, ABT737 and Navitoclax were purchased from Selleckchem (Houston TX, USA). TUNEL- TREVIGEN, cat no-4815-30-K).

Zorea J., Prasad M., Cohen L., Li N., Schefzik R., Ghosh S., Rotblat B., Brors B, & Elkabets M. (2018). IGF1R upregulation confers resistance to isoform-specific inhibitors of PI3K in PIK3CA-driven ovarian cancer. Cell Death & Disease, 9(10), 944.

+ Open protocol

+ Expand

Evaluating mTOR and PI3K Inhibitors in Lung Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lung cancer cells (NCI-H460 cells and H1299 cells) were seeded in complete medium when the cells reached 60%-70% confluence in 6-well plate (Corning) at 37°C in a humidified atmosphere of 5% CO₂ for. The cells were treated with 0.1 or 1 μM mTOR inhibitors, Torin2, WYE-125132, and PI3K inhibitors, GDC0032, PKI-402 (all from Selleckchem, USA). After 1 day, cells were harvested.

Lee M., Song Y., Choi I., Lee S.Y., Kim S., Kim S.H., Kim J, & Seo H.R. (2021). Expression of HYOU1 via Reciprocal Crosstalk between NSCLC Cells and HUVECs Control Cancer Progression and Chemoresistance in Tumor Spheroids. Molecules and Cells, 44(1), 50-62.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!