Pspcas9 bb 2a gfp px458

All cell lines used in this study are listed in Table EV1. All cell lines tested negatively for mycoplasma contamination. HAP1 cell lines were cultured in a humidified growth chamber at 37°C and 5% CO₂ in Iscove's Modified Dulbecco's Medium (IMDM; Sigma‐Aldrich) supplemented with 10% Fetal Bovine Serum (Thermo Fisher Scientific) and 1% (v/v) Penicillin–Streptomycin (Sigma‐Aldrich).
For mutation of the endogenous FBXW7 locus in HAP1 p53⁻ cells, a CRISPR/Cas9 strategy was applied. SgRNAs were cloned into pSpCas9(BB)‐2A‐GFP (PX458, Addgene plasmid #48138). For homologous recombination, a repair template carrying the respective mutation and 1,000 base pair (bp) homology flanks was synthesized as gBlock gene fragment (Integrated DNA Technologies IDT) and inserted into the plasmid pmScarlet_C1 (Addgene plasmid #85042). The plasmid mix of guide RNA plasmid and the repair template was transfected into HAP1 cells using FuGENE HD (Promega). Two days after transfection, cells were sorted for the presence of Cas9 (GFP positive) and repair template (mScarlet positive). Three days later, single cells were sorted into 96‐well plates. Clonal populations were expanded gradually over the course of 3 weeks. The FBXW7 mutations were identified by Sanger Sequencing, and karyotypes of the cell lines were validated by flow cytometry and whole‐genome sequencing.

The pCMV-CD146/ GFP plasmids and corresponding empty vector pCMV-GFP were purchased from Sino Biological Inc. (Beijing, China). Control and exon1 and exon2 directed gRNAs for CD146 were cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to Ann Ran et al. [18 (link)]. DNA oligonucleotides for CD146 guide were exon-3-1_GCTCAGCCTCCAGGACAGAG and guide-exon-3-2_GGAGAGGCCGCACTTCAGAA. Cells were transfected with the plasmids using Lipofectamine 3000 reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. After 48 h, transfected cells were dissociated and GFP positivity cells were sorted by using SH800S Cell Sorter. GG16 transfected cells were maintained in medium with 75 μg/ml Hygromycin and single cell sorted GSC23 control and CD146-ko cells were plated in 96-well plates for expansion. CD146 overexpressing or ablated cells were determined by Western blotting.

Short guide RNAs (sgRNAs) to target DENR promoter were designed using the MIT CRISPR sgRNA design tool (http://crispr.mit.edu/). Double-stranded oligonucleotides representing sgRNAs (S1 File) were then cloned into pSpCas9 (BB)-2A-GFP (PX458) and pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmids 48138 and 62988). Constructs were then co-transfected into HEK293T cells and 24h later selected for puromycin resistance (3 μg/mL) for another 72h. GFP-expressing single cells were sorted using an Aria II FACS and incubated in 96 well dishes for two weeks to form visible cellular clones. DNA was extracted from the clones using QuickExtract solution (Epibio), and successful deletions were confirmed by Sanger sequencing of PCR products. Ribbon sequences were produced using the pyRibbon software which we deposited in https://github.com/AminMahpour/pyRibbon/.

pDZ plasmids contain a bidirectional expression cassette for a given influenza A virus gene segment and have been described previously (45 (link)). pCAGGS-based expression plasmids contain protein-coding sequences under the control of the chicken β-actin promoter (46 (link)). pMD2.G and psPAX2 were a gift from Didier Trono (Addgene; plasmid 12259).
pLVX-IRES-ZsGreen and pLVX-IRES-Puro were purchased from Clontech (respectively, 632187 and 632183). pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene; plasmid 48138) (47 (link)). BiFC expression plasmids for split-YFP were described previously (20 (link)). pmTurquoise2-Mito and pmTurquoise2-ER were a gift from Dorus Gadella (Addgene; plasmids 36208 and 36204, respectively) (48 (link)).

The knockout HEK293A cell line was generated as in [38 (link)] using the HEK293A WT (Thermo Fisher Scientific, Waltham, MA, USA) cell line. Briefly, cell clones with deletions in the region of constitutive proteins encoding exons (Supplementary Figure S1A) were obtained using the CRISPR/Cas9 method. The design of the sgRNAs for human PARP1 gene knockout was performed using the Benchling CRISPR tool (https://www.benchling.com/, accessed on 9 November 2019) to delete the DNA sequence that includes 3–5 exons of the PARP1 gene. The selected protospacers PARP1-gRNA1 (CTAGAACCTCCAATACCATG (TGG)) and PARP1-gRNA2 (GCAAGTGACCACAAAGGTGC (AGG) (PAM sequences in brackets)) were cloned in plasmid pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138).