The largest database of trusted experimental protocols
Sourced in United States, China, Belgium, United Kingdom, Canada, France, New Zealand

SKOV3 is a type of human ovarian cancer cell line commonly used in laboratory research. The SKOV3 cell line is derived from the ascites of a patient with ovarian adenocarcinoma. These cells are routinely used to study various aspects of ovarian cancer, including proliferation, migration, and drug response.

Automatically generated - may contain errors

256 protocols using skov3

1

Ovarian Cancer Cell Line Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ovarian cancer cell line SKOV3 and SNU840 were purchased from The American Type Culture Collection (ATCC) and Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). SKOV3 and SNU840 cells were cultured in RPMI 1640 Medium (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen, shanghai, China), 100 U/mL streptomycin and penicillin (Invitrogen, Carlsbad, CA). All the cells were maintained in incubator at 37°C with 5% CO2. The negative control, LINC00511 and EZH2 siRNAs (Invitrogen) were transfected into SKOV3 and SNU840 cells by using RNAiMAX (Invitrogen) based on the manufacturer’s manual. Fourty‐eight hours post cell transfection, the SKOV3 and SNU840 cells were collected for RNA and total protein extraction. The LINC00511 siRNA sequences are: siRNA 1#,5′‐CCCAUGUCUGCUGUGCCUUUGUACU‐3′ siRNA 2#, 5′‐CCAGUGUGUGCUGAUGACACAUACA‐3′. The EZH2 siRNA sequence is siRNA, 5′‐AAGACUCUGAAUGCAGUUGCU‐3′.
+ Open protocol
+ Expand
2

Culturing SKOV3 and DDP-resistant Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human ovarian cancer cell line SKOV3 was purchased from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. The SKOV3/DDP cell line, which was DDP-resistant, was obtained from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. SKOV3 and SKOV3/DDP cells were cultured in DMEM and Iscove's modified Dulbecco's medium (Invitrogen; Thermo Fisher Scientific, Inc.), respectively. Both cells were supplemented with 10% FBS (Invitrogen; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin solution, and maintained in a humidified incubator with 5% CO2 at 37°C. To maintain DDP resistance, the SKOV3/DDP cell culture solution was incubated with 1 µg/ml DDP. Cells in the logarithmic growth phase were used in subsequent experiments.
+ Open protocol
+ Expand
3

Overexpressing OGN in Ovarian Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ovarian cancer cell lines (SKOV3 and KGN) were purchased from the American Type Culture Collection (ATCC, VA, USA). Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) foetal bovine serum (FBS; Gibco, Invitrogen, Carlsbad, CA, USA) and 1% penicillin/streptomycin (GIBCO, CA, USA) growth media was used to culture SKOV3 and KGN cells. All cells were incubated at 37 °C and 5% CO2. OGN overexpression and empty vector plasmids were purchased from GeneCopoeia Biotechnology (GeneCopoeia Biotechnology, MD, USA). For transient cell transfection, SKOV3 and KGN cells were seeded in 6-well plates for 24 h. After incubation, cells were transfected with 3 μg empty vector and 3 μg OGN overexpression plasmid using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the protocol to establish a cell line with upregulated OGN expression.
+ Open protocol
+ Expand
4

Cytotoxic Effects of CGA on Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human melanoma cell line A375, ovarian cancer cell line SK-OV-3, lung large cell carcinoma cell NCI-H460, squamous cell carcinoma of head and neck cell CAL-27 were purchased from the National Infrastructure of Cell Line Resource (Beijing, China). Breast cancer cell line MDA-MB-231, human T lymphocyte leukemia cell Jurkat E6, human embryonic kidneys cell HEK-293T, and murine colon carcinoma cell MC38 were the storage of our laboratory. Murine breast cancer cell line 4T1 was from the American Type Culture Collection (ATCC, MD, USA).
The A375, MDA-MB-231 and CAL-27 were cultured in the Dulbecco's Modified Eagle's Medium (Invitrogen, CA, USA) with 10% fetal calf serum (FBS, Invitrogen), penicillin (100 U/mL) and streptomycin (100 μg/mL) (Invitrogen). The SK-OV-3 was cultured in the McCoy's 5A Media (Invitrogen) with 10% FBS, penicillin and streptomycin (P/S, Invitrogen). The NCI-H460, Jurkat E6, MC38 and 4T1 were cultured in the RPMI-1640 medium (Invitrogen) supplemented with 10% FBS and P/S. All cells were cultured at 37 °C and 5% CO2.
The A375, SK-OV-3, MDA-MB-231, NCI-H460 and CAL-27 cells were seeded into 12-well plate with full growth medium at 2 × 105 cell per well for 24 h before treatment and cultured overnight. The cells were treated with IFN-γ (10 ng / mL) and different concentrations of CGA (0 - 200 μM) for 48 h.
+ Open protocol
+ Expand
5

Ovarian Cancer Cell Transfection Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ovarian cancer cell lines, SKOV3 and ES-2 were obtained from the American Type Culture Collection, and human ovarian surface epithelial cells (HOSEpiC) were purchased from the BeNa Cell Culture Collection (cat. no. BNCC340096). SKOV3 and ES-2 cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO2. HOSEpiC cells were cultured in DMEM medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS.
SKOV3 cells were transfected with inhibitor control, miR-361-5p inhibitor, TRAF3-short-hairpin (sh)RNA, control-shRNA, miR-361-5p inhibitor + control-shRNA or miR-361-5p inhibitor + TRAF3-shRNA for 48 h using Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A period of 48 h after cell transfection, transfection efficiency was detected using reverse transcription-quantitative (RT-q)PCR.
+ Open protocol
+ Expand
6

Cell Lines for Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human colorectal cancer cells HT29 and human breast cancer cells DU4475 were purchased from ECACC (Porton Down, UK). The human eosinophilic leukemia cell line EOL-1 was purchased from DSMZ (Braunschweig, Germany) and the human ovarian cancer cell line SKOV3 was from ATCC (Manassas, USA). HOS osteosarcoma cells, Molm13 acute myeloid leukemia cells and MV3 melanoma cells (all human) were kindly provided by the Departments of Pediatric Hematology and Oncology, Oncology and Dermatology, respectively (all University Medical Center Hamburg-Eppendorf, UKE). The human pancreatic cancer cell line PaCa5061 was provided by the Department of General, Visceral and Thoracic Surgery at UKE (Kalinina et al. 2010 (link)). The human gastric cancer cell line GC5023 was newly established in the framework of this study (see the next paragraph).
All aforementioned cell lines, except SKOV3, were grown in RPMI-1640 medium with 2 mM L-glutamine, supplemented with 10% fetal calf serum (FCS) and 1% penicillin (50 U/mL) and streptomycin (50 μg/mL) (all from Thermo Fisher Scientific, Waltham, USA), at 37°C with 95% H2O-saturated atmosphere and 5% CO2. SKOV3 cells were cultured in McCoy’s 5A medium containing 10% FCS, 2 mM L-glutamine and 1% penicillin/streptomycin (P/S) (all from Thermo Fisher Scientific).
+ Open protocol
+ Expand
7

Cultivation of Cisplatin-Resistant Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
OC cell lines (SKOV3 and A2780) were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). SKOV3 (the IC50 for DDP is 5.1 μM) and SKOV3/DDP (the IC50 for DDP is 52.7 μM) cells were cultured in Dulbecco's Modified Eagle Medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% foetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA) supplemented with 1% penicillin and streptomycin. A2780 (the IC50 for DDP is 4.8 μM) and A2780/DDP (the IC50 for DDP is 42.4 μM) cells were cultured in RPMI-1640 (Gibco) containing 10% FBS and 1% penicillin and streptomycin. DDP (6 μM) was added to the medium used for culturing SKOV3/DDP and A2780/DDP cells to maintain resistance. All cells were cultured in a humidified incubator at 37 °C in an atmosphere of 5% CO2.
+ Open protocol
+ Expand
8

Culturing Diverse Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T, SKOV3, OVCAR3, HeLa, MEF cells were purchased from ATCC (Manassas, VA, USA).RM1 and Myc-CaP were gifts from the R. Blasberg lab (Memorial Sloan Kettering Cancer Center). All cells were grown at 37 °C and 5% CO2 incubator. HEK293T, SKOV3, HeLa, RM1, Myc-CaP, MEF cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) with 10% fetal bovine serum (FBS, Gibco); SKOV3 was supplemented with 100 μg/mL primocin (InvivoGen), and RM1 and Myc-CaP were supplemented with 1X penicillin/streptomycin. OVCAR3 cells were grown in RPMI-1640 medium with 20% FBS supplemented with 100 μg/mL primocin.
+ Open protocol
+ Expand
9

Culturing Human Ovarian Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human EOC cell lines OVCAR-3 (HTB-161) and SK-OV-3 (HTB-77) were purchased from ATCC (Wesel, Germany) and cultured at 37°C in a 5% CO2-containing humidified atmosphere. The SK-OV-3-Luc IP1 cell line, a more aggressive, luciferase positive OC cell line compared to the SK-OV-3 cell line, was created through in vivo selection and cultured at 37°C in a 10% CO2-containing humidified atmosphere. Short tandem repeat profiling was conducted as previously described.21 (link) The SK-OV-3 cell line and SK-OV-3 Luc IP1 cell lines were cultured both in Dulbecco’s Modified Eagle Medium (DMEM, Life Technologies, Merelbeke, Belgium), while the OVCAR-3 cell line was cultured in RPMI 1640 Medium supplemented with Gibco GlutaMAXTM (Life Technologies, Merelbeke, Belgium). All mediums were supplemented with 2% penicillin/streptomycin (Life Technologies) and 10% FCS (Sigma-Aldrich, Overijse, Belgium).
+ Open protocol
+ Expand
10

Culturing Human Ovarian Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human ovarian cancer cell lines SKOV3 and OVCAR3 were purchased from the American Type Culture Collection. McCoy’s 5A medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen), 100 U/ml penicillin (Invitrogen), and 100 mg/ml streptomycin (Invitrogen) was used to culture SKOV3 cells. OVCAR3 cells were cultured in RPMI 1640 medium (Invitrogen) supplemented with 20% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin. Cells were cultured at 37°C in 5% CO2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!