Brightstar biodetect kit

Northern blotting was performed as described previously65 (link) with slight modification. Briefly, 5 μg of tissue RNAs were separated in 1% formaldehyde denatured agarose gel and hydrostatically transferred to Hybond N+ membrane (GE Healthcare, Chalfont St Giles, UK). Membranes were ultraviolet-crosslinked and prehybridized in the hybridization buffer. Hybridization was performed overnight at 42 °C in ULTRAhyb Buffer (Ambion) containing 10 ng ml⁻¹ of biotin-labelled RNA probe, which had been denatured at 90 °C for 10 min. Membranes were stringently washed at 55 °C in 2 × SSC containing 0.1% SDS and in 0.1 × SSC containing 0.1% SDS, twice each, and the bound probe was visualized using a BrightStar BioDetect Kit (Ambion), according to the manufacturer's protocol.

Total RNA was isolated from GAS strains grown to the transitional growth phase in THY (OD₆₀₀ of 0.8) as described above. RNA samples (10 μg) were loaded onto an 8% TBE-Urea polyacrylamide gel and separated by electrophoresis. Size standards (Ultra Low Range Ladder, Fermentas) were loaded on the same gel. RNA was electroblotted onto positively charged nylon membranes (Ambion) and UV cross-linked. Templates for the probes were generated by PCR with the same primers that were used for the PCR reaction in the RT-qPCR experiments. To the 5′ end of the reverse primers was added the T7 promoter sequence (CTTAATACGACTCACTATAGGG) for in vitro transcription (MAXIscript™ T7 Transcription Kit, Ambion). Probes were labelled with biotin prior to hybridization (Brightstar Psoralen-Biotin Labeling kit, Ambion). Membranes were hybridized overnight with a RNA probe complementary to MarS or 5 S RNA, as indicated. A BrightStar BioDetect Kit (Ambion) was used for detection, and autoradiography films were exposed to the luminescent blots.

Bacterial strains were cultured and β-galactosidase assay was performed, as described above. Simultaneously, aliquots of the same culture were taken and total RNA was extracted, as described previously^{71 (link)}. RNA concentrations were measured spectrophotometrically and 15 μg of RNA was resolved on 6% polyacrylamide gel electrophoresis. RNA was transferred to 0.2 μm pore size Nytran N (Whatman) membrane, as described previously⁷² . Membrane was prehybridized for 45 min in ULTRAhyb (Ambion) solution at 42 °C. Blots were probed overnight with 5′-biotinylated SgrS-bio or ssrA-bio probes specific for SgrS sRNA and 5 S rRNA, respectively (Supplementary Table 2). BrightStar BioDetect kit (Ambion) was used for detection. ImageJ (National Institutes of Health⁷³ ) was used to measure band densities from two independent experiments.

Genomic DNA of 15 selected Musaceae representatives was prepared from nuclei isolated from healthy young leaf tissue. Aliquots of genomic DNA samples corresponding to16×10⁶ of nuclear genomes were digested using DraI, EcoRV, RsaI or MspI restriction enzymes, size-fractionated by 1.2% agarose gel electrophoresis, and transferred onto Hybond N+ nylon membranes (Amersham Biosciences, Bath, UK). Biotin-labeled oligomers (file S3) were used as probes. The Southern hybridization was done at 68°C overnight followed by stringent washes (stringency 90%). Signals were detected using the BrightStar BioDetect kit according to the manufacturer's instructions (Ambion, Austin, USA), incubated with chemiluminescent substrate (CDP-Star, Amersham Biosciences), and exposed to X-ray film.

For northern blotting, samples containing peptidyl-tRNA were separated by 11% polyacrylamide gel prepared with WIDE RANGE Gel buffer, transferred onto a Hybond-N+ membrane (GE Healthcare), and hybridized with biotinylated oligodeoxynucleotide probes (purchased from Invitrogen) complementary to either tRNA^Gly or tRNA^Pro using NorthernMax kit (Ambion). Signals were detected with streptavidin-alkaline phosphatase using the BrightStar BioDetect kit (Ambion). Images were visualized and analyzed by LAS600 luminoimager (GE healthcare). The probes used were GlyT (5′-CAGCTTGGAAGGCTGAGGTAATAGC-3′), ProM (5′-CACTGGTCCCAAACCAGTTGC-3′), ProK (5′-CCTTCGTCCCGAACGAAGTGC-3′) and ProL (5′-CCCGACACCCCATGACGGTGC-3′). The GlyT probe was used for the detection of tRNA^Gly, whereas the ProM and ProK probes were mixed and used for the detection of tRNA^Pro on the peptidyl-tRNA of the ApcA derivatives (Figure 6B). The ProL probe was used for the detection of tRNA^Pro that recognizes the CCC codon (Figure 6D and E).

mRNA was isolated from intracellular RNA extracted from CK cells at 24 h.p.i. using a Poly(A) Purist MAG kit (Ambion), following the manufacturer′s protocol. Northern blot analysis was carried out using a NothernMax-Gly kit (Ambion). Briefly, after denaturation at 50 °C with an equal volume of glyoxal loading dye for 30 min, mRNA was separated in a 1.1 % low-electroendosmosis (LE) agarose gel. The mRNA was transferred to a BrightStar-Plus positively charged nylon membrane via capillary action for 90 min and cross-linked by UV exposure (using the auto crosslink function of a Stratalinker UV Cross-linker; Stratagene). The membrane was pre-hybridized with ULTRAhyb buffer for 30 min at 42 °C, before overnight incubation at 42 °C with a DNA probe specific for the 3′ end of the genome (forward primer, 5′-CAACAGCGCCCAAAGAAG-3′, within the N gene and reverse primer located in the 3′-UTR, 5′-GCTCTAACTCTATACTAGCCT-3′). The membrane was washed and the blot developed using a BrightStar Biodetect kit (Ambion), following the manufacturer′s protocol.

Strains carrying plasmids were grown overnight in LB with ampicillin. They were then subcultured into fresh media with antibiotics and grown to mid-log phase. When cultures reached an OD₆₀₀ of ~0.3, 0.5 mM IPTG was added, and samples were harvested at different time points. RNA was extracted by the hot phenol method as described in reference 72.
Northern blot analysis was carried out as described in reference 73. Briefly, 7 µg total RNA (for DicF) or 10 µg total RNA (for xylR and pykA mRNAs) was run on acrylamide gels and 1% agarose gels using 1× Tris-acetate-EDTA (TAE) or 1× MOPS (morpholinepropanesulfonic acid) buffer, respectively. RNA in acrylamide gels was transferred to a 0.2-µm-pore-size membrane (Whatman) in 0.5× TAE buffer by electrophoresis. RNA in agarose gels was transferred by capillary transfer using 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Following transfer, the membranes were probed overnight with biotinylated DNA oligonucleotides (IDT) complementary to the respective RNAs. Detection was carried out according to the instructions for the Brightstar Biodetect kit (Ambion).