Abi prism 7700 sequence

Total RNA was isolated from resected frozen specimens by using RNAspin Mini (GE Healthcare, Tokyo, Japan) and the first-strand cDNA was synthesized from 1 μg RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, USA), according to the manufacturer’s protocol. Real-time quantitative PCR analysis was carried out using an ABI Prism 7700 sequence detector system (Applied Biosystems). All primer/probe sets were purchased from Applied Biosystems. PCR was carried out using the TaqMan Universal PCR Master Mix (Applied Biosystems) using 1 μl of cDNA in a 20 μl final reaction volume. The PCR thermal cycle conditions were as follows: initial step at 95°C for 10 min, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 min. The expression level of the housekeeping gene β2-microglobulin was measured as an internal reference with a standard curve to determine the integrity of template RNA for all specimens. The ratio of the mRNA level of each gene was calculated as follows: (absolute copy number of each gene)/(absolute copy number of β2-microglobulin).

The differential expression of Fcer1g, Nnmt, Cuedc1, Slc30a10, Gpr126 and Lars2 was further evaluated by SYBR green-based qRT-PCR in mouse inner ear cDNA samples of knock-in and wild-type mice (n = 6 each). qRT-PCR primers and probes of each gene were designed using ABI Primer Express Software v2.0 (Applied Biosystems, Foster City, CA, USA). qRT-PCR analysis of the cDNA samples was performed using the ABI Prism 7700 sequence detection system (Applied Biosystems) following the standard procedure. Data were analyzed using the ABI Prism 7500 SDS software (Applied Biosystems). Quantitative expression data of each specific target were obtained for each cDNA sample. Expression of Gapdh was used as endogenous normalization control. The comparative threshold of cycle (C_T) method was used to determine any difference in target expression between the homozygous p.V37I knock-in and wild-type mice. All values were log₂ transformed before statistical anaylsis.

The total RNA was isolated from isolated glomeruli or GMCs with TRIzol (Invitrogen, Carlsbad, CA). The reverse transcriptase reactions were performed using the QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA). Real-time PCR was performed in triplicate on this cDNA using the ABI Prism 7700 sequence-detection system (Applied Biosystems, Foster City, CA). Designed Taqman® probes Mm01178820_m1, Mm01274281_g1 and Mm03944483_s1 for TGF-β₁, ILK, and α-SMA were used following the manufacturer’s instructions (Applied Biosystems, Foster city, CA). The fold-change analysis was based on the normalised RNA levels by β-actin in the same sample.

DNA was extracted from 10⁶ PBMCs using proteinase K and salting-out method. The HTLV-1 proviral load was quantified using a real-time TaqMan PCR method as previously described using the ABI Prism 7700 Sequence detector system (Applied Biosystems) [28 (link)]. Albumin DNA was used as an endogenous reference. The normalized value of the HTLV-1 proviral load was calculated as the ratio of (HTLV-1 DNA average copy number/albumin DNA average copy number) × 2 × 10⁶ and expressed as the number of HTLV-1 copies per 10⁶ PBMCs.

The ratio of mitochondrial DNA to nuclear DNA provides an assessment of the volume of mitochondria per cell in a given tissue. Nuclear DNA and mtDNA was amplified and quantified using real-time PCR with an ABI PRISM 7700 sequence detector (Applied Biosystems). A 120-bp long region of mtDNA was amplified for quantification by PCR and cloned into the plasmid pCDNAII, following the manufacture’s procedure (Invitrogen), then sequenced to verify the identity of the DNA. The DNA concentration was estimated by spectrophotometry and calculated to give a stock of 2.5E10 copy/μL. Amplification and quantification prior to cloning was completed using the following PCR procedure: one cycle at 50°C for 2 minutes, followed by 95°C for 10 minutes, then 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The amount of DNA was quantitated using the following assay during PCR: 50 μL containing 10 μL DNA template, 11 μL of 25 mmol/L MgCl₂, 0.05 μL AMPErase UNG (uracil-N-glycosylase), 15.25 μL DI water, 0.25 μLAmpliTaq Gold DNA Polmerase, 1 μL of each dNTP, and 5 μL of 10X buffer A. The copy numbers of the unknown was determined by creating a standard curve from a plasmid of known copy number. These results were normalized by also amplifying the 120-bp region, then cloning it (as described above).

Total RNA was isolated using Qiazol and RNeasy kit (Qiagen, Manchester, UK) according to the manufacturer's instructions. SuperScript II Reverse Transcriptase (Invitrogen) and random hexamer primer were used for synthesis of complementary DNA. qRT‐PCR reactions were performed using an ABI Prism 7700 sequence detector (Applied Biosystems, Paisley, UK). SYBR green kit (Applied Biosystems) and primers specific for CDKN1A (FW 5′‐TAGCAGCGGAACAAGGAG‐3′, RW 5′‐AAACGGGAACCAGGACAC‐3′), CDK4 (FW 5′‐TTGGCAGCTGGTCACATGGT‐3′, RW 5′‐CAGATCAAGGGAGACCCTCACG‐3′), ING4 (FW 5′‐TGCGGGGATGTATTTGGAACA‐3′, RW 5′‐TTTCAGCCTTCAGGTCCTCTG‐3′), ING5 (FW 5′‐CGCCATGTACTTGGAGCACTA‐3′, RW 5′‐TTCTTATCTTCCGTCCTCTGGT‐3′), TP53I3 (FW 5′‐TTCACCAAAGGTGCTGGAGTT‐3′, RW 5′‐ACCCATCGACCATCAAGAGC‐3′) and TP53 (FW 5′‐AGGCCTTGGAACTCAAGGAT‐3′, RW 5′‐CCCTTTTTGGACTTCAGGTGF‐3′). Samples from at least 3 independent healthy donors and indicated number of CLL patient samples were used for each target gene and run in technical triplicate. Values were normalized to the reference gene hARP (FW 5′‐CGCTGCTGAACATGCTAA‐3′, RW 5′‐TGTCGAACACCTGCTGGATG‐3′).