Trelief 5α

E. coli Trelief5α (catalog no. TSC-C01, Tsingke, Hangzhou, China) and DH5α (catalog no. 9027, Takara Biotechnology, Dalian, China) were used as the cloning hosts for plasmid manipulation and construction and cultivated in LB media [tryptone (10 g/liter), NaCl (10 g/liter), and yeast extract (5 g/liter)] supplemented with ampicillin (100 μg/ml) at 37°C. SOC medium (LB medium supplemented with 2.5 mM KCl, 10 mM MgCl₂, and 20 mM glucose) was used as the recovery medium for heat shock–transformed E. coli. The S. cerevisiae strain BY4741 (MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0) and diploid ER (his3Δ0 leu2Δ0 trp1Δ0 ura3Δ0) were used in this study for assessing ADE2 gene editing efficiency. YPD medium [tryptone (20 g/liter), glucose (20 g/liter), and yeast extract (10 g/liter)] was used to grow yeast cells before transformation. After transformation, cells were grown in synthetic complete minus uracil (SC-U) medium. SC-U agar plates with low (10 mg/liter) adenine hemisulfate were used to screen for ADE2 edited cells.

The codon-optimized protein coding sequences (CDS) of SmCASP3/6/7/8 and SmGSDMEa/b were amplified by PCR. The CDS of SmGSDMEa-NT₂₆₂, SmGSDMEa-NT₂₀₂, SmGSDMEa-CT₂₆₂, SmGSDMEa-CT₂₀₂, SmGSDMEb-NT and SmGSDMEb-CT were subcloned from the above cloning sequence. Site-directed mutations of SmGSDMEa Asp202 to Ala (D202A), Asp259 to Ala (D259A), Asp262 to Ala (D262A), and mutation of SmGSDMEb Asp246 to Ala (D246A) were performed using the Hieff Mut Site-Directed Mutagenesis Kit (Yeasen, Shanghai, China). The recombinant plasmid was introduced into Trelief 5α (Tsingke Biological Technology, Beijing, China) by transformation. The mutations were verified by sequencing analysis. The primers used are listed in Table S1.

PNPT1 gene was knock out in A549 cell using the CRISPR‐Cas9 System. The gRNA:ATAGTGCTCGCACTTGCAAC (designed in http://crispr.mit.edu) was linked into the CRISPR Cas9 Plasmid (Genscript; Nanjing, China) and transformed into competent cell (Trelief 5α, Tsingke; Beijing, China). Harvested plasmids after 16 h cultivation were transfected into the cells using lipofectamine 3000 (Invitrogen; Carlsbad, CA) according to manufacturer's protocol. Cells were then screened out by 50 µm puromycin (Sangon Biotech) and seeded onto 96‐well plate to cultivate monoclonal cell. The monoclonal cells were selected through subculture and PNPT1 protein expression was examined by Western blot.