Atg5 sirna

Manufactured by GenePharma

Sourced in China

ATG5 siRNA is a small interfering RNA (siRNA) that targets the ATG5 gene, which is involved in the autophagy process. This product is designed to specifically silence the expression of the ATG5 gene, which can be used as a research tool to study autophagy in various biological systems.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SiRNAs (565 citations) SiRNA against ATG5 (2 citations)

17 protocols using atg5 sirna

ATG5 Knockdown and Overexpression Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to previously reported methods [19 (link), 20 (link)], the BEAS-2B and HBSMC cells were transfected with 20 nM of human control small interference RNA (siRNA, 5ʹ-UUCUCCGAACGUGUCACGA-3ʹ) or ATG5 siRNA (5ʹ-CATCTGAGCTACCCGGATA-3ʹ) using Lipofectamine 2000 reagent for 48 h. The products of control siRNA or ATG5 siRNA were purchased from GenePharma (http://www.genepharma.com/en/, Shanghai, China). The results of ATG5 siRNA transfection were confirmed by western blotting (Supplementary Fig. 1).
As previously reported [21 (link), 22 (link)], the BEAS-2B and HBSMC cells were transfected with adenovirus vector encoding human ATG5 cDNA or vector control (GenePharma, Shanghai, China) for 24 h using Liposome 8000 reagent. ATG5 overexpression adenovirus were obtained through cloning the cDNA of ATG5 gene (Forward, 5′-GTCAGATCCGCTAGAGATCTGCTTACTAAGTTTGGCTTTGGTT-3′ and reverse, 5′-GATATCTTATCTAGAAGCTTAAGGGTGACATGCTCTGATAAAT-3′) into the pAdTrack-CMV. The results of ATG5 cDNA transfection were confirmed by western blotting (Supplementary Fig. 2).

Xu J., Yu Z, & Liu X. (2023). Angiotensin-(1–7) suppresses airway inflammation and airway remodeling via inhibiting ATG5 in allergic asthma. BMC Pulmonary Medicine, 23, 422.

+ Open protocol

+ Expand

ZNF32 Overexpression and Autophagy Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pSG5-ZNF32 over-expression plasmid was constructed by inserting expanded ZNF32 cDNA (NCBI Reference Sequence: NM_006973.2) fragments into pSG5 vectors stored in our lab. RFP-LC3 was stored in our lab. ZNF32, Atg5 and non-target siRNA were purchased from Genepharm (Shanghai, China), ZNF32 siRNA: GUCAGAAAGGAAGCUUAAUTT (sense 5′-3′), Atg5 siRNA: AUCCCAUCCAGAGUUGCUUGUGAUC (sense 5′-3′), non-target siRNA: UUCUUCGAACGUGUCACGUTT (sense 5′-3′). Transfections were mediated by TurboFect Transfection Reagent (Thermo Fisher Scientific, Waltham, MA). Cells were pre-cultured in serum-free DMEM for 2 h before transfection. Then, 6 μg plasmid or 10 nmol siRNA was introduced into the cell using 6 μl transfection reagent according to the manufacturer's instructions. The punctiform aggregates and cells were counted at a final magnification of 400×. The percentage of positive cells with at least 5 punctiform aggregates was calculated; at least 600 cells were observed.

Li Y., Zhang L., Li K., Li J., Xiang R., Zhang J., Li H., Xu Y., Wei Y., Gao J., Lin P, & Wei Y. (2015). ZNF32 inhibits autophagy through the mTOR pathway and protects MCF-7 cells from stimulus-induced cell death. Scientific Reports, 5, 9288.

+ Open protocol

+ Expand

siRNA Transfection and Silibinin Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cells were seeded onto a culture dish. Transfection of siRNA was performed by using Lipofectamine 2000 (Invitrogen, Eugene, OR) according to the manufacturer’s instructions.
ATG5 SiRNA (5′-GACGUUGGUAACUGACAAATT-3′),
BNIP3 SiRNA (5′- GAUUACUUCUGAGCUUGCATT-3′),
AIF SiRNA (5′-GCAGUGGCAAGUUACUUAUTT-3′)
and scrambled SiRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) were all purchased from GenePharma Company (Suzhou, China). After SiRNA transfection overnight, the cells were incubated with silibinin at indicated dosage for subsequent experiments.

Wang C., He C., Lu S., Wang X., Wang L., Liang S., Wang X., Piao M., Cui J., Chi G, & Ge P. (2020). Autophagy activated by silibinin contributes to glioma cell death via induction of oxidative stress-mediated BNIP3-dependent nuclear translocation of AIF. Cell Death & Disease, 11(8), 630.

+ Open protocol

+ Expand

Hydrogen Peroxide Cytotoxicity in SH-SY5Y

Check if the same lab product or an alternative is used in the 5 most similar protocols

SH-SY5Y cells (2×10⁵) cells were seeded onto a culture dish in a diameter of 10 cm. Transfection of siRNA was performed by using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instructions. The ATG5 siRNA (5′-GACGUUGGUAACUGACAAATT-3′), and scrambled siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) were purchased from GenePharma Company (Suzhou, China). After siRNA transfection overnight, the cells were incubated with H₂O₂ at indicated dose for subsequent experiments.

Gao Z., Wang H., Zhang B., Wu X., Zhang Y., Ge P., Chi G, & Liang J. (2018). Trehalose inhibits H2O2-induced autophagic death in dopaminergic SH-SY5Y cells via mitigation of ROS-dependent endoplasmic reticulum stress and AMPK activation. International Journal of Medical Sciences, 15(10), 1014-1024.

+ Open protocol

+ Expand

LIMP-2 Knockdown and Overexpression in HNSCC

Check if the same lab product or an alternative is used in the 5 most similar protocols

For knocking down the expression of LIMP-2, the specific shRNA against LIMP-2 (shLIMP-2) and control shRNA (shCtrl) were constructed and packaged by Ubigene Biosciences (Guangzhou, China). The specific targeting sequence was as follows: shLIMP-2 (mouse): 5’-GGGTCTATGGATGAGGGAA-3’. The 4MOSC2 and SCC7 cells were infected with polybrene and lentiviral supernatant and then screened with 4 μg·mL⁻¹ puromycin (Sigma‒Aldrich, USA). The Protein levels were verified using Western blot.
Full-length mouse LIMP-2 complementary DNA was PCR amplified and cloned into the pcDNA3.1 plasmid vector (Tsingke Biotechnology Co. Ltd., China). β-catenin-siRNA (5ʹ-UACAUCAUUUGUAUUCUGCTT-3ʹ), ATG5-siRNA (5ʹ- GCGGUUGAGGCUCACUUUATT-3ʹ), and ATG7-siRNA (5ʹ-GCUAGAGACGUGACACAUATT-3ʹ) were from GenePharma (Suzhou, China). The mRFP-GFP-LC3 plasmid were kindly donated by Dr. T Yoshimori and distributed by Addgene. All the plasmids were transfected into HNSCC cells using Lipofectamine™ 3000 following protocol (Invitrogen, USA).

Liu Y., Li S., Wang S., Yang Q., Wu Z., Zhang M., Chen L, & Sun Z. (2023). LIMP-2 enhances cancer stem-like cell properties by promoting autophagy-induced GSK3β degradation in head and neck squamous cell carcinoma. International Journal of Oral Science, 15, 24.

+ Open protocol

+ Expand

GFP-LC3 Autophagy Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The GFP-tagged LC3 cDNA expression construct was a gift from Dr. Noboru Mizushima (Tokyo Medical and Dental University, Tokyo, Japan). The miRNA mimics, miRNA inhibitors, ATG5 siRNA, ATG12 siRNA, pDsRed1 Atg12 were synthesized by GenePharma (Shanghai, China). Cells were transfected using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer's protocol.

Pan B., Feng B., Chen Y., Huang G., Wang R., Chen L, & Song H. (2015). MiR-200b regulates autophagy associated with chemoresistance in human lung adenocarcinoma. Oncotarget, 6(32), 32805-32820.

+ Open protocol

+ Expand

GFP-tagged LC3 Autophagy Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The GFP-tagged LC3 cDNA expression construct was a gift from Dr. Noboru Mizushima (Tokyo Medical and Dental University, Tokyo, Japan). Both miR-24-3p inhibitor (AmiR-24-3p) and miR-24-3p precursor (PmiR-24-3p) were provided by Applied Biosystem (Life Technologies). ATG5 siRNA, ATG4A siRNA, pDsRed1/Atg4A were purchased from GenePharma (Shanghai, China). Cells were transfected by using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer's protocol.

Pan B., Chen Y., Song H., Xu Y., Wang R, & Chen L. (2014). Mir-24-3p downregulation contributes to VP16–DDP resistance in small-cell lung cancer by targeting ATG4A. Oncotarget, 6(1), 317-331.

+ Open protocol

+ Expand

Autophagy Regulation via HMGB1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The GFP-tagged LC3 cDNA expression construct was a gift from Dr. Noboru Mizushima (Tokyo Medical and Dental University, Tokyo, Japan). P-Babe-Puro-MEK-DD, which constitutively expresses activated MEK1-DD (S218D/S222D), was purchased from Addgene Inc. (Cambridge, MA). Transfections with pcDNA3.1-HMGB1, HMGB1 shRNA, Atg5 siRNA, mTOR siRNA, PI3K-III siRNA and MEK siRNA (all obtained from GenePharma, Shanghai, China) were performed using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer’s protocol.

Pan B., Chen D., Huang J., Wang R., Feng B., Song H, & Chen L. (2014). HMGB1-mediated autophagy promotes docetaxel resistance in human lung adenocarcinoma. Molecular Cancer, 13, 165.

+ Open protocol

+ Expand

Targeting Autophagy and YAP in SW480 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small interfering (si) RNA targeting Atg5 and YAP, and scramble siRNA were synthesized by Shanghai GenePharma Co., Ltd. The sequences of the siRNAs are as follows: Atg5 siRNA, 5′-GCAACUCUGGAUGGGAUUGTT-3′; YAP siRNA, 5′-CGAGAUGAGAGCACAGACAdTdT-3′; negative control (NC) of Atg5 (siScramble#1; 5′-GGAAAGAGCUGCAUAUUAATT-3′); and NC of YAP, (siScramble#2; 5′-UAAGGCUAUGAAGAGAUAC-3′). The SW480 cells were transfected with the siRNAs (50 nmol/l) at 37°C for 48 h using Lipofectamine^® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. At 72 h post-transfection, the cells were harvested and used for subsequent experiments.
The pEGFP-LC3 plasmid was kindly gifted by Dr Lu Zhang (Sichuan University, Chengdu, China). The SW480 cells were transfected with the pEGFP-LC3 plasmid (2.5 µg) at 37°C using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. After 36 h at 37°C, the cells were treated with DMSO or TCG (0.4 µM) for another 36 h at 37°C. Formation of EGFP-LC3 puncta was visualized using fluorescence microscopy (FV1000; Olympus Corporation).

Zhou L., Wang J., Liu J., Liang J., Wang Y., Cai Q, & Huang Y. (2021). YAP activation attenuates toxicarioside G-induced lethal autophagy arrest in SW480 colorectal cancer cells. Oncology Reports, 46(4), 224.

+ Open protocol

+ Expand

ATG5 Silencing in DHA-Treated HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

HUVECs at 50% confluence were transiently transfected with ATG5 siRNA (GenePharma, Suzhou, China) by using Lipofectamine^TM 2000 (Invitrogen, Carlsbad, CA). After transfection for 48 h, the medium was replaced with normal DMEM medium, and cells were treated with DHA (35 μM) for 24 h. Scramble siRNA was used as a negative control. The effect of gene silencing was estimated by Western blot.

Liu J., Ren Y., Hou Y., Zhang C., Wang B., Li X., Sun R, & Liu J. (2019). Dihydroartemisinin Induces Endothelial Cell Autophagy through Suppression of the Akt/mTOR Pathway. Journal of Cancer, 10(24), 6057-6064.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!